LCE3C (NM_178434) Human Untagged Clone
CAT#: SC307177
LCE3C (untagged)-Human late cornified envelope 3C (LCE3C)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LEP15; SPRL3A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307177 representing NM_178434.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCTGCCAGCAAAACCAGCAGCAGTGCCAGCCCCCTCCCAGTTGTCCCTCACCCAAGTGTCCCCCA AAGAGCCCAGCACAGTGTCTGCCTCCACCCTCTTCTGACTGTGCTCTAAGCTCCGGGGGCTGTGGCCCC AGTTCTGAAAGTGGCTGCTGCCTGAGCCACCACAGGCACTTCAGGTCCCATCAATGCCGGCGCCAGAGA TCCAACTCCTGTGACAGGGGCAGTGGTCAGCAAGGCGGGGGCTCCTGCCGTGGCCATGGCTCTGGGGGC TGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_178434 |
Insert Size | 285 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_178434.2 |
RefSeq Size | 425 bp |
RefSeq ORF | 285 bp |
Locus ID | 353144 |
UniProt ID | Q5T5A8 |
MW | 9.7 kDa |
Gene Summary | A structural component of the cornified envelope of the stratum corneum involved in innate cutaneous host defense (Probable). Possesses defensin-like antimicrobial activity against a broad spectrum of Gram-positive and Gram-negative bacteria, both aerobic and anaerobic species. Upon inflammation, may regulate skin barrier repair by shaping cutaneous microbiota composition and immune response to bacterial antigens (PubMed:28634035).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221967 | LCE3C (Myc-DDK-tagged)-Human late cornified envelope 3C (LCE3C) |
CNY 1,200.00 |
|
RC221967L3 | Lenti ORF clone of Human late cornified envelope 3C (LCE3C), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221967L4 | Lenti ORF clone of Human late cornified envelope 3C (LCE3C), mGFP tagged |
CNY 5,890.00 |
|
RG221967 | LCE3C (tGFP-tagged) - Human late cornified envelope 3C (LCE3C) |
CNY 2,800.00 |