United States
Germany
Japan
United Kingdom
China
TCF23 (NM_175769) Human Untagged Clone
CAT＃: SC307030
TCF23 (untagged)-Human transcription factor 23 (TCF23)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bHLHa24; OUT; TCF-23 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_175769 edited
AAGGCCTCCTCAGGCACTGTGTTTCTGCTCTGTGGGCTGCAGCCCCAGTGGGGTGGCATG TCACAGAGGAAGGCCAGAGGGCCACCAGCCATGCCAGGGGTGGGGCATAGCCAGACTCAG GCCAAAGCACGGTTGCTGCCAGGCGCTGACAGGAAGAGGAGCCGCCTCAGCAGGACAAGG CAGGACCCGTGGGAAGAAAGAAGCTGGAGCAACCAGAGATGGAGCAGAGCTACCCCTGGC CCTCGAGGGACCAGGGCTGGGGGCCTGGCTCTTGGCAGGAGCGAGGCCAGTCCTGAGAAT GCCGCGCGGGAGCGGAGCCGGGTCAGGACGCTGCGCCAGGCCTTCTTGGCCTTGCAGGCT GCTCTGCCTGCCGTGCCGCCCGACACCAAGCTCTCCAAGTTGGACGTGCTGGTGCTCGCC GCCAGCTACATAGCCCACCTCACCCGCACACTCGGCCACGAGTTGCCTGGCCCTGCCTGG CCGCCCTTCCTGCGTGGACTCCGCTACTTGCACCCTCTCAAGAAGTGGCCGATGCGATCT CGTCTCTATGCTGGAGGCCTGGGGTACTCCGATCTTGACTCCACCACAGCCAGCACCCCC AGCCAAAGAACAAGAGATGCAGAGGTGGGGTCCCAAGTCCCTGGAGAGGCAGATGCTCTC CTTTCCACCACACCACTCTCACCAGCTCTTGGTGACAAATAATTATCACACTCGCCCTTT TCTCCTAGACTGTGACTCATGCTTATGGGCCTGGATTTTCTACCAGCCCCCAGATTCTCA GCCATC |
| Restriction Sites | Please inquire |
| ACCN | NM_175769 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_175769.1, NP_786951.1 |
| RefSeq Size | 645 bp |
| RefSeq ORF | 645 bp |
| Locus ID | 150921 |
| UniProt ID | Q7RTU1 |
| Gene Summary | The gene encodes a member of the basic helix-loop-helix transcription factor family. Studies of the orthologous gene in mouse have shown the encoded protein does not bind DNA but may negatively regulate other basic helix-loop-helix factors via the formation of a functionally inactive heterodimeric complex. [provided by RefSeq, May 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221910 | TCF23 (Myc-DDK-tagged)-Human transcription factor 23 (TCF23) |
CNY 2,400.00 |
|
| RC221910L1 | Lenti ORF clone of Human transcription factor 23 (TCF23), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC221910L2 | Lenti ORF clone of Human transcription factor 23 (TCF23), mGFP tagged |
CNY 5,890.00 |
|
| RC221910L3 | Lenti ORF clone of Human transcription factor 23 (TCF23), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC221910L4 | Lenti ORF clone of Human transcription factor 23 (TCF23), mGFP tagged |
CNY 5,890.00 |
|
| RG221910 | TCF23 (tGFP-tagged) - Human transcription factor 23 (TCF23) |
CNY 4,370.00 |
