CFC1 (NM_032545) Human Untagged Clone
CAT#: SC305469
CFC1 (untagged)-Human cripto, FRL-1, cryptic family 1 (CFC1)
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CFC1B; CRYPTIC; DTGA2; HTX2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_032545 edited
GGCTGAGGAAGGGAAGGGAACATCCACATCTTCTGTACTCGTCCATTCTGTGTCCCCGGG GCCTGGAGTAAAGACACCTTCAAATGCAGAGACTCTTCAGATTCAGCTTTCCTGGAAACT GATCTTCAATGCACTAAGAGAAGGAGACTCTCAAACCAAAAATGACCTGGAGGCACCATG TCAGGCTTCTGTTTACGGTCAGTTTGGCATTACAGATCATCAATTTGGGAAACAGCTATC AAAGAGAGAAACATAACGGCGGTAGAGAGGAAGTCACCAAGGTTGCCACTCAGAAGCACC GACAGTCACCGCTCAACTGGACCTCCAGTCATTTCGGAGAGGTGACTGGGAGCGCCGAGG GCTGGGGGCCGGAGGAGCCGCTCCCCTACTCCCGGGCTTTCGGAGAGGGTGCGTCCGCGC GGCCGCGCTGCTGCAGGAACGGCGGTACCTGCGTGCTGGGCAGCTTCTGCGTGTGCCCGG CCCACTTCACCGGCCGCTACTGCGAGCATGACCAGAGGCGCAGTGAATGCGGCGCCCTGG AGCACGGAGCCTGGACCCTCCGCGCCTGCCACCTCTGCAGGTGCATCTTCGGGGCCCTGC ACTGCCTCCCCCTCCAGACGCCTGACCGCTGTGACCCGAAAGACTTCCTGGCCTCCCACG CTCACGGGCCGAGCGCCGGGGGCGCGCCCAGCCTGCTACTCTTGCTGCCCTGCGCACTCC TGCACCGCCTCCTGCGCCCGGATGCGCCCGCGCACCCTCGGTCCCTGGTCCCTTCCGTCC TCCAGCGGGAGCGGCGCCCCTGCGGAAGGCCGGGACTTGGGCATCGCCTTTAATTTTCTA TGTTGTAAATAATAGATGTGTTTAGTTTACCGTAAGCTGAAGCACTGGGTGAATATTTTT ATTGGGTAATAAATATTTTCATGAAAGCGCCTTTGGCTCCAGAT |
Restriction Sites | Please inquire |
ACCN | NM_032545 |
Insert Size | 900 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032545.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032545.2, NP_115934.1 |
RefSeq Size | 1009 bp |
RefSeq ORF | 672 bp |
Locus ID | 55997 |
UniProt ID | P0CG37 |
Gene Summary | This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211976 | CFC1 (Myc-DDK-tagged)-Human cripto, FRL-1, cryptic family 1 (CFC1) |
CNY 3,600.00 |
|
RC211976L1 | Lenti ORF clone of Human cripto, FRL-1, cryptic family 1 (CFC1), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC211976L2 | Lenti ORF clone of Human cripto, FRL-1, cryptic family 1 (CFC1), mGFP tagged |
CNY 6,000.00 |
|
RC211976L3 | Lenti ORF clone of Human cripto, FRL-1, cryptic family 1 (CFC1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211976L4 | Lenti ORF clone of Human cripto, FRL-1, cryptic family 1 (CFC1), mGFP tagged |
CNY 5,890.00 |
|
RG211976 | CFC1 (tGFP-tagged) - Human cripto, FRL-1, cryptic family 1 (CFC1) |
CNY 4,370.00 |