United States
Germany
Japan
United Kingdom
China
GPR110 (ADGRF1) (NM_025048) Human Untagged Clone
CAT＃: SC305221
GPR110 (untagged)-Human G protein-coupled receptor 110 (GPR110), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GPR110; hGPCR36; KPG_012; PGR19 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_025048 edited
CCAGGGAAAATGAAAGTTGGAGTGCTGTGGCTCATTTCTTTCTTCACCTTCACTGACGGC CACGGTGGCTTCCTGGGGAAAAATGATGGCATCAAAACAAAAAAAGAACTCATTGTGAAT AAGAAAAAACATCTAGGCCCAGTCGAAGAATATCAGCTGCTGCTTCAGGTGACCTATAGA GATTCCAAGGAGAAAAGAGATTTGAGAAATTTTCTGAAGCTCTTGAAGCCTCCATTATTA TGGTCACATGGGCTAATTAGAATTATCAGAGCAAAGGCTACCACAGACTGCAACAGCCTG AATGGAGTCCTGCAGTGTACCTGTGAAGACAGCTACACCTGGTTTCCTCCCTCATGCCTT GATCCCCAGAACTGCTACCTTCACACGGCTGGAGCACTCCCAAGCTGTGAATGTCATCTC AACAACCTCAGCCAGAGTGTCAATTTCTGTGAGAGAACAAAGATTTGGGGCACTTTCAAA ATTAATGAAAGGTTTACAAATGACCTTTTGAATTCATCTTCTGCTATATACTCCAAATAT GCAAATGGAATTGAAATTCAACTTAAAAAAGCATATGAAAGAATTCAAGGTTTTGAGTCG GTTCAGGTCACCCAATTTCGAATGTCACTCTTGTCGCCCAAGTTGGAGTGCAATGGCACA ATCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_025048 |
| Insert Size | 650 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | ORF was fully sequenced and it perfectly matches with NM_025048.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_025048.2, NP_079324.2 |
| RefSeq Size | 1437 bp |
| RefSeq ORF | 657 bp |
| Locus ID | 266977 |
| UniProt ID | Q5T601 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | Orphan receptor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate 3'-terminal exon, compared to variant 1, resulting in the shorter isoform (2) with a unique C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219437 | GPR110 (Myc-DDK-tagged)-Human G protein-coupled receptor 110 (GPR110), transcript variant 2 |
CNY 2,400.00 |
|
| RC219437L3 | Lenti ORF clone of Human G protein-coupled receptor 110 (GPR110), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219437L4 | Lenti ORF clone of Human G protein-coupled receptor 110 (GPR110), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG219437 | GPR110 (tGFP-tagged) - Human G protein-coupled receptor 110 (GPR110), transcript variant 2 |
CNY 4,370.00 |
