IFNA13 (IFNA1) (NM_024013) Human Untagged Clone
CAT#: SC305088
IFNA1 (untagged)-Human interferon, alpha 1 (IFNA1)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IFL; IFN; IFN-ALPHA; IFN-alphaD; IFNA13; IFNA@; leIF D |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_024013 edited
CCATCTCAGCAAGCCCAGAAGTATCTGCAATATCTACGATGGCCTCGCCCTTTGCTTTAC TGATGGTCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCTGTGATCTCCCTG AGACCCACAGCCTGGATAACAGGAGGACCTTGATGCTCCTGGCACAAATGAGCAGAATCT CTCCTTCCTCCTGTCTGATGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATG GCAACCAGTTCCAGAAGGCTCCAGCCATCTCTGTCCTCCATGAGCTGATCCAGCAGATCT TCAACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTAGACAAAT TCTGCACCGAACTCTACCAGCAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGA GGGTGGGAGAAACTCCCCTGATGAATGCGGACTCCATCTTGGCTGTGAAGAAATACTTCC GAAGAATCACTCTCTATCTGACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCA GAGCAGAAATCATGAGATCCCTCTCTTTATCAACAAACTTGCAAGAAAGATTAAGGAGGA AGGAATAACATCTGGTCCAACATGAAAACAATTCTTATTGACTCATACACCAGGTCACGC TTTCATG |
Restriction Sites | Please inquire |
ACCN | NM_024013 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_024013.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024013.1, NP_076918.1 |
RefSeq Size | 876 bp |
RefSeq ORF | 570 bp |
Locus ID | 3439 |
UniProt ID | P01562 |
Protein Families | Druggable Genome |
Protein Pathways | Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway |
Gene Summary | This gene is a member of the alpha interferon gene cluster on chromosome 9. The encoded cytokine is a member of the type I interferon family that is produced in response to viral infection as a key part of the innate immune response with potent antiviral, antiproliferative and immunomodulatory properties. This cytokine, like other type I interferons, binds a plasma membrane receptor made of IFNAR1 and IFNAR2 that is ubiquitously expressed, and thus is able to act on virtually all body cells. This cytokine is upregulated in preeclamptic placentas and is thought to be a mediator of preeclampsia. [provided by RefSeq, Aug 2020] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210902 | IFNA1 (Myc-DDK-tagged)-Human interferon, alpha 1 (IFNA1) |
CNY 2,400.00 |
|
RC210902L1 | Lenti ORF clone of Human interferon, alpha 1 (IFNA1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210902L2 | Lenti ORF clone of Human interferon, alpha 1 (IFNA1), mGFP tagged |
CNY 5,890.00 |
|
RC210902L3 | Lenti ORF clone of Human interferon, alpha 1 (IFNA1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210902L4 | Lenti ORF clone of Human interferon, alpha 1 (IFNA1), mGFP tagged |
CNY 4,800.00 |
|
RG210902 | IFNA1 (tGFP-tagged) - Human interferon, alpha 1 (IFNA1) |
CNY 4,000.00 |