LY6G6D (NM_021246) Human Untagged Clone
CAT#: SC304931
LY6G6D (untagged)-Human lymphocyte antigen 6 complex, locus G6D (LY6G6D)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf23; G6D; LY6-D; MEGT1; NG25 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_021246 edited
AACAATGAAACCCCAGTTTGTTGGGATCTTGCTCAGCTCCCTGCTAGGGGCTGCCTTGGG AAACCGAATGCGGTGCTACAACTGTGGTGGAAGCCCCAGCAGTTCTTGCAAAGAGGCCGT GACCACCTGTGGCGAGGGCAGACCCCAGCCAGGCCTGGAACAGATCAAGCTACCTGGAAA CCCCCCAGTGACCTTGATTCACCAACATCCAGCCTGCGTCGCAGCCCATCATTGCAATCA AGTGGAGACAGAGTCGGTGGGAGACGTGACTTATCCAGCCCACAGGGACTGCTACCTGGG AGACCTGTGCAACAGCGCCGTGGCAAGCCATGTGGCCCCTGCAGGCATTTTGGCTGCAGC AGCTACCGCCCTGACCTGTCTCTTGCCAGGACTGTGGAGCGGATAG |
Restriction Sites | Please inquire |
ACCN | NM_021246 |
Insert Size | 400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021246.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021246.2, NP_067069.2 |
RefSeq Size | 402 bp |
RefSeq ORF | 402 bp |
Locus ID | 58530 |
UniProt ID | O95868 |
Gene Summary | LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]).[supplied by OMIM, Apr 2009] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223536 | LY6G6D (Myc-DDK-tagged)-Human lymphocyte antigen 6 complex, locus G6D (LY6G6D) |
CNY 1,200.00 |
|
RC223536L1 | Lenti ORF clone of Human lymphocyte antigen 6 complex, locus G6D (LY6G6D), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC223536L2 | Lenti ORF clone of Human lymphocyte antigen 6 complex, locus G6D (LY6G6D), mGFP tagged |
CNY 5,890.00 |
|
RC223536L3 | Lenti ORF clone of Human lymphocyte antigen 6 complex, locus G6D (LY6G6D), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC223536L4 | Lenti ORF clone of Human lymphocyte antigen 6 complex, locus G6D (LY6G6D), mGFP tagged |
CNY 3,600.00 |
|
RG223536 | LY6G6D (tGFP-tagged) - Human lymphocyte antigen 6 complex, locus G6D (LY6G6D) |
CNY 2,800.00 |