PSMC3IP (NM_016556) Human Untagged Clone
CAT#: SC304432
PSMC3IP (untagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GT198; HOP2; HUMGT198A; ODG3; TBPIP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_016556, the custom clone sequence may differ by one or more nucleotides
ATGAGTAAAGGCCGGGCAGAAGCTGCGGCGGGAGCCGCCGGGATCCTCCTGAGGTACCTG CAGGAGCAGAACCGGCCCTACAGCTCCCAGGATGTGTTCGGGAACCTACAGCGGGAACAC GGACTGGGCAAGGCGGTGGTGGTGAAGACGCTGGAGCAGCTGGCGCAACAAGGCAAGATC AAAGAGAAGATGTACGGCAAGCAGAAGATCTATTTTGCGGATCAGGACCAGTTTGACATG GTGAGTGATGCTGACCTTCAAGTCCTAGATGGCAAAATCGTGGCCCTCACTGCTAAGGTG CAGAGCTTGCAGCAGAGCTGCCGCTACATGGAGGCTGAGCTCAAGGAATTATCTAGTGCC CTGACCACACCAGAGATGCAGAAAGAAATCCAGGAGTTAAAGAAGGAATGCGCTGGCTAC AGAGAGAGATTGAAGAACATTAAAGCAGCTACCAATCATGTGACTCCAGAAGAGAAAGAG CAGGTGTACAGAGAGAGGCAGAAGTACTGTAAGGAGTGGAGGAAGAGGAAGAGGATGGCT ACAGAGCTGTCTGATGCAATACTTGAAGGATACCCCAAGAGCAAGAAGCAGTTCTTTGAG GAAGTTGGGATAGAGACGGATGAAGATTACAACGTCACACTCCCAGACCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_016556 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016556.1, NP_057640.1 |
RefSeq Size | 1349 bp |
RefSeq ORF | 654 bp |
Locus ID | 29893 |
UniProt ID | Q9P2W1 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that functions in meiotic recombination. It is a subunit of the PSMC3IP/MND1 complex, which interacts with PSMC3/TBP1 to stimulate DMC1- and RAD51-mediated strand exchange during meiosis. The protein encoded by this gene can also co-activate ligand-driven transcription mediated by estrogen, androgen, glucocorticoid, progesterone, and thyroid nuclear receptors. Mutations in this gene cause XX female gonadal dysgenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) encodes the longest isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220984 | PSMC3IP (Myc-DDK-tagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 2 |
CNY 3,990.00 |
|
RC220984L3 | Lenti-ORF clone of PSMC3IP (Myc-DDK-tagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 2 |
CNY 5,890.00 |
|
RC220984L4 | Lenti-ORF clone of PSMC3IP (mGFP-tagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 2 |
CNY 5,890.00 |
|
RG220984 | PSMC3IP (tGFP-tagged) - Human PSMC3 interacting protein (PSMC3IP), transcript variant 2 |
CNY 4,370.00 |
其它PSMC3IP产品