TAF13 (NM_005645) Human Untagged Clone
CAT#: SC303676
TAF13 (untagged)-Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MRT60; TAF(II)18; TAF2K; TAFII-18; TAFII18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303676 representing NM_005645.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGATGAGGAAGAAGACCCCACGTTTGAGGAAGAAAATGAAGAAATTGGAGGAGGTGCAGAAGGT GGACAGGGTAAAAGAAAGAGACTTTTTTCTAAAGAATTGCGATGTATGATGTATGGCTTTGGGGATGAC CAGAATCCTTATACTGAGTCAGTGGATATTCTTGAAGATCTTGTCATAGAGTTTATCACTGAAATGACT CACAAGGCAATGTCAATTGGAAGACAAGGTCGAGTACAAGTTGAAGATATCGTCTTCTTGATTCGAAAG GACCCAAGGAAGTTTGCCAGGGTTAAAGACTTGCTTACTATGAATGAAGAATTGAAACGAGCTAGAAAA GCATTTGATGAAGCAAATTATGGATCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_005645 |
Insert Size | 375 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005645.3 |
RefSeq Size | 577 bp |
RefSeq ORF | 375 bp |
Locus ID | 6884 |
UniProt ID | Q15543 |
Protein Families | Transcription Factors |
Protein Pathways | Basal transcription factors |
MW | 14.3 kDa |
Gene Summary | Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit associated with a subset of TFIID complexes. This subunit interacts with TBP and with two other small subunits of TFIID, TAF10 and TAF11. There is a pseudogene located on chromosome 6. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212721 | TAF13 (Myc-DDK-tagged)-Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13) |
CNY 1,200.00 |
|
RC212721L1 | Lenti ORF clone of Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212721L2 | Lenti ORF clone of Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13), mGFP tagged |
CNY 5,890.00 |
|
RC212721L3 | Lenti ORF clone of Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212721L4 | Lenti ORF clone of Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13), mGFP tagged |
CNY 5,890.00 |
|
RG212721 | TAF13 (tGFP-tagged) - Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13) |
CNY 2,800.00 |