GGA1 (NM_001001561) Human Untagged Clone
CAT#: SC300218
GGA1 (untagged)-Human golgi-associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADP-ribosylation factor binding protein 1; gamma-adaptin related protein 1; golgi associated, gamma adaptin ear containing, ARF binding protein 1; OTTHUMP00000028975; OTTHUMP00000042200 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001001561, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCCGCGATGGAGCCGGAGACTCTGGAGGCGCGAATCAATAGAGCCACGAACCCC CTGAACAAGGAGCTCGACTGGGCCAGCATCAACGGCTTCTGCGAGCAGCTCAACGAGGAC TTTGAGGGGCCTCCACTCGCCACCCGGCTGCTGGCCCACAAGATCCAGTCCCCACAGGAG TGGGAGGCGATCCAGGCCTTGACGGTGAGAAGGGGAGAGGCCACCATCCGTCCCCCGCCA TGTGACGACACCAAGGGAGGCCAAGACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001001561 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001561.1, NP_001001561.1 |
RefSeq Size | 1723 bp |
RefSeq ORF | 270 bp |
Locus ID | 26088 |
Protein Families | Druggable Genome |
Protein Pathways | Lysosome |
Gene Summary | This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks multiple 3' exons and has an alternate 3' end, as compared to variant 1. The encoded isoform 3 has a shorter and distinct C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224640 | GGA1 (Myc-DDK-tagged)-Human golgi-associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1), transcript variant 3 |
CNY 3,990.00 |
|
RC224640L3 | Lenti-ORF clone of GGA1 (Myc-DDK-tagged)-Human golgi-associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1), transcript variant 3 |
CNY 5,890.00 |
|
RC224640L4 | Lenti-ORF clone of GGA1 (mGFP-tagged)-Human golgi-associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1), transcript variant 3 |
CNY 5,890.00 |
|
RG224640 | GGA1 (tGFP-tagged) - Human golgi-associated, gamma adaptin ear containing, ARF binding protein 1 (GGA1), transcript variant 3 |
CNY 4,370.00 |