GABPB2 (GABPB1) (NM_181427) Human Untagged Clone
CAT#: SC109259
GABPB1 (untagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-3
CNY 3,656.00
CNY 5,610.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BABPB2; E4TF1; E4TF1-47; E4TF1-53; E4TF1B; GABPB; GABPB-1; GABPB2; NRF2B1; NRF2B2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_181427 edited
TCAGCCCGGCCGGGTACGAGGCGCCTCGGGTCCCCGCACCACCTCCTGCTGCCTTCCCGT CGCCGCTCCCGAAGCTTTTCCAGATGTCCCTGGTAGATTTGGGAAAGAAGCTTTTAGAAG CGGCACGAGCAGGTCAAGATGATGAAGTTCGTATTTTGATGGCAAATGGAGCTCCCTTTA CTACAGACTGGCTGGGAACTTCTCCACTTCATCTAGCAGCACAGTATGGTCATTATTCCA CCACAGAGGTACTGCTGCGAGCTGGTGTGAGCAGAGATGCCAGAACCAAAGTGGACCGAA CACCATTACATATGGCAGCTTCTGAGGGCCATGCCAGCATAGTAGAGGTTTTACTTAAGC ATGGTGCTGATGTCAATGCAAAGGACATGTTAAAGATGACAGCTCTCCATTGGGCCACAG AACACAATCATCAAGAGGTGGTGGAACTTTTAATCAAATATGGTGCTGATGTACACACGC AAAGTAAATTTTGTAAAACTGCATTTGATATTTCAATAGACAATGGAAATGAAGATTTAG CAGAGATATTACAGATTGCTATGCAGAACCAAATCAACACAAACCCAGAGAGTCCTGACA CTGTGACAATACATGCTGCAACACCACAGTTTATCATTGGACCTGGAGGGGTGGTGAACC TAACAGATGAAACGGGTGTATCTGCTGTTCAGTTTGGAAACTCTTCTACATCAGTATTAG CTACATTAGCTGCCTTAGCTGAAGCATCTGCTCCATTGTCCAATTCTTCAGAAACTCCAG TAGTGGCCACAGAAGAAGTAGTTACTGCAGAATCTGTGGATGGTGCCATTCAGCAAGTAG TTAGTTCAGGGGGTCAGCAAGTCATCACAATAGTTACAGATGGAATTCAGCTTGGAAATT TGCACTCTATTCCAACCAGTGGAATTGGTCAGCCCATCATTGTGACCATGCCAGATGGAC AACAAGTATTAACAGTACCAGCAACAGACATTGCTGAAGAAACTGTTATAAGTGAAGAAC CACCAGCTAAGAGACAATGTATCGAAATAATTGAAAACCGGGTGGAATCTGCAGAAATAG AAGTAAGGAGTCTTTTACCCGGTGTGCTTTGCCGCAGTCATCCAAAATAA |
Restriction Sites | NotI-NotI |
ACCN | NM_181427 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181427.2, NP_852092.1 |
RefSeq Size | 1436 bp |
RefSeq ORF | 1047 bp |
Locus ID | 2553 |
UniProt ID | Q06547 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (gamma 3) contains multiple differences compared to variant beta 1, resulting in a shorter isoform (gamma 2) that lacks a 12-amino acid serine-rich region, compared to isoform beta 1. Both this variant (gamma 3) and gamma 2 encode the same isoform (gamma 2), however, they differ in the 5' UTR. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212837 | GABPB1 (Myc-DDK-tagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-3 |
CNY 3,656.00 |
|
RC212837L3 | Lenti-ORF clone of GABPB1 (Myc-DDK-tagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-3 |
CNY 5,890.00 |
|
RC212837L4 | Lenti-ORF clone of GABPB1 (mGFP-tagged)-Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-3 |
CNY 5,890.00 |
|
RG212837 | GABPB1 (tGFP-tagged) - Human GA binding protein transcription factor, beta subunit 1 (GABPB1), transcript variant gamma-3 |
CNY 4,370.00 |