LYPD6B (NM_177964) Human Untagged Clone

CAT#: SC107028

LYPD6B (untagged)-Human LY6/PLAUR domain containing 6B (LYPD6B)



  "NM_177964" in other vectors (4)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT116; LYPD7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_177964 edited
ATGTTGCTGATTACTCTGAGTGCAAACCTTTTCACTGTTCCAGAGAGGAGCCTGACAACC
ACATTCTCCTTCTCAAGATATAAGAGTTCGGACCGCCCAGCACACAAGGTCAGCATGCTG
CTCCTCTGTCACGCTCTCGCTATAGCTGTTGTCCAGATCGTTATCTTCTCAGAAAGCTGG
GCATTTGCCAAGAACATCAACTTCTATAATGTGAGGCCTCCTCTCGACCCTACACCATTT
CCAAATAGCTTCAAGTGCTTTACTTGTGAAAACGCAGGGGATAATTATAACTGCAATCGA
TGGGCAGAAGACAAATGGTGTCCACAAAATACACAGTACTGTTTGACAGTTCATCACTTC
ACCAGCCACGGAAGAAGCACATCCATCACCAAAAAGTGTGCCTCCAGAAGTGAATGTCAT
TTTGTCGGTTGCCACCACAGCCGAGATTCTGAACATACGGAGTGTAGGTCTTGCTGTGAA
GGAATGATCTGCAATGTAGAATTACCCACCAATCACACTAATGCAGTGTTTGCCGTAATG
CACGCTCAGAGAACATCTGGCAGCAGTGCCCCCACACTCTACCTACCAGTGCTTGCCTGG
GTCTTTGTGCTTCCATTGCTGTGA
Restriction Sites NotI-NotI     
ACCN NM_177964
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_177964.3.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177964.3, NP_808879.2
RefSeq Size 1600 bp
RefSeq ORF 624 bp
Locus ID 130576
UniProt ID Q8NI32
Protein Families Druggable Genome, Transmembrane
Gene Summary Believed to act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro acts on nAChRs in a subtype- and stoichiometry-dependent manner. Modulates specifically alpha-3(3):beta-4(2) nAChRs by enhancing the sensitivity to ACh, decreasing ACh-induced maximal current response and increasing the rate of desensitization to ACh; has no effect on alpha-7 homomeric nAChRs; modulates alpha-3(2):alpha-5:beta-4(2) nAChRs in the context of CHRNA5/alpha-5 variant Asn-398 but not its wild-type sequence.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...