Vps26a (NM_001007740) Rat Untagged Clone
CAT#: RN202230
Vps26a (untagged ORF) - Rat vacuolar protein sorting 26 homolog A (S. pombe) (Vps26a), (10 ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Vps26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN202230 representing NM_001007740
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTTTTCTTGGAGGCTTTTTTGGTCCCATCTGTGAGATCGATGTTGCCCTTAGTGATGGGGAGACCA GGAAAATGGCAGAAATGAAAACGGAAGATGGCAAAGTAGAAAAACACTATCTCTTCTATGATGGGGAATC TGTCTCAGGAAAGGTAAACCTAGCCTTTAAGCAGCCTGGAAAGAGGCTAGAGCATCAAGGAATTAGAATT GAATTTGTAGGTCAAATTGAGCTTTTCAATGACAAGAGTAATACTCATGAATTTGTAAACCTAGTGAAGG AACTAGCCTTGCCTGGAGAGCTGACTCAGAGCAGAAGCTATGACTTTGAATTCATGCAAGTTGAAAAGCC ATATGAGTCATACATCGGTGCCAATGTCCGCCTGAGGTATTTCCTTAAGGTGACCATTGTGAGAAGACTG ACAGACTTAGTGAAAGAGTACGATCTTATTGTTCACCAGCTCGCCACCTACCCAGAGGTCAACAACTCCA TTAAAATGGAGGTGGGAATTGAAGACTGTCTGCACATAGAGTTTGAGTACAATAAGTCCAAGTATCATTT AAAGGATGTAATTGTTGGAAAAATTTACTTCTTATTAGTAAGAATAAAAATACAACACATGGAGTTACAG CTGATCAAGAAAGAGATCACAGGAATTGGACCCAGCACCACAACAGAGACAGAAACAATCGCTAAGTATG AAATAATGGATGGGGCGCCAGTAAAAGGAGAATCTATTCCGATAAGATTGTTCTTAGCAGGGTATGACCC AACCCCCACAATGAGAGATGTGAACAAGAAGTTTTCAGTAAGGTACTTTTTGAACCTCGTGCTTGTTGAT GAGGAGGACAGAAGGTACTTCAAGCAGCAGGAGATTATCCTGTGGAGAAAAGCACCTGAGAAACTGAGAA AACAGAGGACGAACTTTCACCAGCGATTTGAATCTCCAGAATCGCAGGCGTCTGCAGAACAGCCTGAGAT GTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007740 |
Insert Size | 984 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001007740.1, NP_001007741.1 |
RefSeq Size | 1292 bp |
RefSeq ORF | 984 bp |
Locus ID | 361846 |
UniProt ID | Q6AY86 |
Gene Summary | Acts as component of the retromer cargo-selective complex (CSC). The CSC is believed to be the core functional component of retromer or respective retromer complex variants acting to prevent missorting of selected transmembrane cargo proteins into the lysosomal degradation pathway. The recruitment of the CSC to the endosomal membrane involves RAB7A and SNX3.The SNX-BAR retromer mediates retrograde transport of cargo proteins from endosomes to the trans-Golgi network (TGN) and is involved in endosome-to-plasma membrane transport for cargo protein recycling. The SNX3-retromer mediates the retrograde endosome-to-TGN transport of WLS distinct from the SNX-BAR retromer pathway. The SNX27-retromer is believed to be involved in endosome-to-plasma membrane trafficking and recycling of a broad spectrum of cargo proteins. The CSC complex seems to act as recruitment hub for other proteins, such as the WASH complex and TBC1D5. Required for retrograde transport of lysosomal enzyme receptor IGF2R. Required to regulate transcytosis of the polymeric immunoglobulin receptor (pIgR-pIgA). Required for the endosomal localization of WASHC2 (indicative for the WASH complex). Required for the endosomal localization of TBC1D5. Mediates retromer cargo recognition of SORL1 and is involved in trafficking of SORL1 implicated in sorting and processing of APP. Involved in retromer-independent lysosomal sorting of F2R. Involved in recycling of ADRB2. Acts redundantly with VSP26B in SNX-27 mediated endocytic recycling of SLC2A1/GLUT1. Enhances the affinity of SNX27 for PDZ-binding motifs in cargo proteins (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR202230 | Vps26a (Myc-DDK-tagged ORF) - Rat vacuolar protein sorting 26 homolog A (S. pombe) (Vps26a), (10 ug) |
CNY 3,990.00 |
|
RR202230L3 | Lenti ORF clone of Vps26a (Myc-DDK-tagged ORF) - Rat vacuolar protein sorting 26 homolog A (S. pombe) (Vps26a), (10 ug) |
CNY 6,080.00 |
|
RR202230L4 | Lenti ORF clone of Vps26a (mGFP-tagged ORF) - Rat vacuolar protein sorting 26 homolog A (S. pombe) (Vps26a), (10 ug) |
CNY 6,650.00 |