Arc (NM_001276684) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	Arc3.1; arg3.1; C86064; mArc
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC227478 representing NM_001276684 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTGGACCATATGACCACCGGCGGCCTCCACGCCTACCCTGCCCCGCGGGGTGGGCCGGCCGCCA AACCCAATGTGATCCTGCAGATTGGTAAGTGCCGAGCTGAGATGCTGGAACACGTACGGAGGACCCACCG GCATCTGTTGACCGAAGTGTCCAAGCAGGTGGAGCGAGAGCTGAAAGGGTTGCACAGGTCGGTGGGCAAG CTGGAGAACAACTTGGACGGCTACGTGCCCACCGGCGACTCACAGCGCTGGAAGAAGTCCATCAAGGCCT GTCTTTGCCGCTGCCAGGAGACCATCGCCAACCTGGAGCGCTGGGTCAAGCGTGAGATGCACGTGTGGAG GGAGGTCTTCTACCGTCTGGAGAGGTGGGCTGACCGCCTGGAGTCCATGGGCGGCAAATACCCAGTGGGC AGCGAGCCGGCCCGCCACACTGTCTCTGTAGGTGTGGGGGGTCCAGAGCCCTACTGCCAGGAAGCTGATG GCTATGACTATACCGTTAGCCCCTATGCCATCACCCCGCCACCTGCCGCAGGAGAACTGCCTGAACAGGA GTCAGTTGAGGCTCAGCAATATCAGTCTTGGGGGCCAGGTGAGGATGGGCAACCGAGCCCTGGTGTGGAT ACACAGATCTTCGAGGACCCACGGGAGTTCCTGAGCCACCTGGAAGAGTACCTGCGGCAGGTGGGTGGCT CTGAAGAATATTGGCTGTCCCAGATCCAGAACCACATGAATGGGCCAGCCAAGAAGTGGTGGGAGTTCAA GCAGGGCTCGGTGAAGAACTGGGTGGAGTTCAAGAAGGAGTTTCTGCAATACAGTGAGGGTACACTCTCC CGTGAAGCCATTCAGCGGGAGCTGGAGCTGCCGCAGAAGCAGGGTGAACCACTCGACCAGTTCCTCTGGC GCAAGCGGGACCTGTACCAGACACTGTATGTGGACGCTGAGGAGGAGGAGATCATTCAGTATGTGGTGGG CACCCTGCAGCCCAAACTCAAGCGCTTTCTGCGCCACCCACTCCCCAAGACCCTGGAGCAGCTTATCCAG AGGGGTATGGAAGTGCAGGACGGCCTGGAGCAGGCAGCTGAGCCTTCTGGCACCCCACTGCCCACAGAGG ATGAGACGGAGGCACTCACACCTGCTCTTACCAGCGAGTCAGTAGCCAGTGACAGGACCCAGCCTGAATA G ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001276684
Insert Size	1191 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001276684.1, NP_001263613.1
RefSeq Size	3056 bp
RefSeq ORF	1191 bp
Locus ID	11838
UniProt ID	Q9WV31
Gene Summary	Master regulator of synaptic plasticity that self-assembles into virion-like capsids that encapsulate RNAs and mediate intercellular RNA transfer in the nervous system (By similarity). ARC protein is released from neurons in extracellular vesicles that mediate the transfer of ARC mRNA into new target cells, where ARC mRNA can undergo activity-dependent translation (By similarity). ARC capsids are endocytosed and are able to transfer ARC mRNA into the cytoplasm of neurons (By similarity). Acts as a key regulator of synaptic plasticity: required for protein synthesis-dependent forms of long-term potentiation (LTP) and depression (LTD) and for the formation of long-term memory (PubMed:29264923, PubMed:24094104). Regulates synaptic plasticity by promoting endocytosis of AMPA receptors (AMPARs) in response to synaptic activity: this endocytic pathway maintains levels of surface AMPARs in response to chronic changes in neuronal activity through synaptic scaling, thereby contributing to neuronal homeostasis (PubMed:17088213, PubMed:20211139, PubMed:20228806). Acts as a postsynaptic mediator of activity-dependent synapse elimination in the developing cerebellum by mediating elimination of surplus climbing fiber synapses (PubMed:23791196). Accumulates at weaker synapses, probably to prevent their undesired enhancement (By similarity). This suggests that ARC-containing virion-like capsids may be required to eliminate synaptic material (By similarity). Required to transduce experience into long-lasting changes in visual cortex plasticity and for long-term memory (PubMed:17088210, PubMed:20228806). Involved in postsynaptic trafficking and processing of amyloid-beta A4 (APP) via interaction with PSEN1 (PubMed:22036569). In addition to its role in synapses, also involved in the regulation of the immune system: specifically expressed in skin-migratory dendritic cells and regulates fast dendritic cell migration, thereby regulating T-cell activation (PubMed:28783680).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 3' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the protein described in PMIDs: 10727859 and 22036569. This protein is encoded by two splice variants which are supported by AK157822.1 and AF162777.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 22036569. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.