Rnaseh1 (NM_001286865) Mouse Untagged Clone

CAT#: MC226630

Rnaseh1 (untagged) - Mouse ribonuclease H1 (Rnaseh1), transcript variant 1



  "NM_001286865" in other vectors (1)

CNY 2,570.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226630 representing NM_001286865
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCTATGCGGTGAGGAGAGGCCGCAGGACCGGAGTCTTCCTGAGTTGGAGTGAGTGCAAAGCCCAGG
TGGACCGGTTTCCTGCTGCCAGGTTTAAGAAATTTGCCACAGAAGATGAGGCCTGGGCCTTTGTCAGGAG
CTCTTCAAGCCCGGATGGTTCAAAAGGGCAGGAAAGTGCACATGAGCAGAAGTCACAGGCGAAGACCAGC
AAGCGGCCTCGGGAGCCCCTGGGTGAAGGGGAAGAACTTCCAGAGCCAGGGCCGAAGCACACACGACAGG
ACACCGAGCCCTCGGCTGTAGTGAGCAAGGACGCATTTTCTTATATGGGAGAGTCAGTCGTTGTCTACAC
GGATGGCTGTTGCTCCAGTAATGGACGGAAGCGGGCACGAGCAGGAATTGGCGTTTACTGGGGCCCAGGC
CACCCCTTAAATGTAGGTATAAGGCTTCCTGGGCGACAGACAAACCAGAGGGCCGAGATCCATGCAGCCT
GCAAGGCCATCATGCAAGCCAAGGCTCAGAACATCAGCAAGCTGGTTCTGTACACAGACAGCATGTTCAC
CATCAATGGGATAACTAACTGGGTTCAGGGCTGGAAGAAGAATGGCTGGAGAACAAGTACAGGGAAAGAT
GTGATCAACAAGGAGGACTTCATGGAGCTGGACGAGCTCACTCAGGGCATGGACATCCAGTGGATGCACA
TTCCTGGTCACTCAGGATTTGTGGGCAATGAAGAGGCCGACAGACTGGCACGGGAAGGAGCGAAGCAGTC
TGAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286865
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286865.1, NP_001273794.1
RefSeq Size 1472 bp
RefSeq ORF 780 bp
Locus ID 19819
Gene Summary This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and is necessary for DNA replication and repair. This enzyme is present in both mitochondria and nuclei, which are resulted from translation of a single mRNA with two in-frame initiation start codons. The use of the first start codon produces the mitochondrial isoform and the use of the second start codon produces the nuclear isoform. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF) which encodes 7aa in mouse. An alternately spliced transcript variant has been found which is a candidate for nonsense-mediated mRNA decay (NMD). [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (1) is derived from the upstream AUG start codon, while the shorter isoform (2) is derived from the downstream AUG start codon. This RefSeq represents the shorter isoform (2), which is a nuclear protein (see details in PMID: 20823270).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...