Acer2 (NM_001290543) Mouse Untagged Clone

CAT#: MC226369

Acer2 (untagged) - Mouse alkaline ceramidase 2 (Acer2), transcript variant 3



  "NM_001290543" in other vectors (1)

CNY 2,190.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410116I05Rik; Asah3l; CRG-L1; maCER2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226369 representing NM_001290543
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCGCCCCGCACTGGTGGGACCACCTGCGGGCTGGCAGTTCGGAGGTGGATTGGTGCGAGGACAACT
ACACTATCGTGCCTGCCATTGCCGAGTTCTACAACACGATCAGCAACGTCTTGTTTTTCATTTTACCTCC
CATCTGCATGTGCTTGTTCCGCCAGTACGCAACGTGCTTCAACAGCGGCATCTACTTAATATGGACGCTC
CTAGTTGTAGTGGGGATTGGATCTGTCTACTTCCATGCAACGCTGAGTTTCCTGGGTCAGATGCTTGATG
AACTTGCCATTCTGTGGGTTCTGATGTGTGCTTTGGCCATGTGGTTTCCCAGGAGGTATTTACCAAAGAT
CTTTCGGAATGACAGGGGCAGGTTCAAGGCAGTGGTGTGTGTCCTGTCTGCAATTACAACGTGCTTGGCG
TTTATCAAGCCCGCCATCAACAATATTTCCCTGATGATTCTGGGACTTCCATGCACTGCGCTGCTTGTTG
CAGAGCTGAAGAGGTGTGACAATGTGCGTGTGTTTAAGCTGGGCCTCTTCTCTGGCCTCTGGTGGACTCT
GGCTCTCTTCTGCTGGATCAGCGACCAAGCCTTCTGTGAGCTGCTCTCCTCCTTTCACTTCCCCTACCTG
CACTGTGTGTGGAGTGCTGACAGAGGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001290543
Insert Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290543.1, NP_001277472.1
RefSeq Size 1175 bp
RefSeq ORF 660 bp
Locus ID 230379
UniProt ID Q8VD53
Gene Summary Golgi ceramidase that catalyzes the hydrolysis of ceramides into sphingoid bases like sphingosine and free fatty acids at alkaline pH (PubMed:29401619). Ceramides, sphingosine, and its phosphorylated form sphingosine-1-phosphate are bioactive lipids that mediate cellular signaling pathways regulating several biological processes including cell proliferation, apoptosis and differentiation (PubMed:29401619). Has a better catalytic efficiency towards unsaturated long-chain ceramides, including C18:1-, C20:1- and C24:1-ceramides (By similarity) (PubMed:29401619). Saturated long-chain ceramides and unsaturated very long-chain ceramides are also good substrates, whereas saturated very long-chain ceramides and short-chain ceramides are poor substrates. Also hydrolyzes dihydroceramides to produce dihydrosphingosine (By similarity). It is the ceramidase that controls the levels of circulating sphingosine-1-phosphate and dihydrosphingosine-1-phosphate in plasma through their production by hematopoietic cells (PubMed:29401619). Regulates cell proliferation, autophagy and apoptosis by the production of sphingosine and sphingosine-1-phosphate. As part of a p53/TP53-dependent pathway, promotes for instance autophagy and apoptosis in response to DNA damage. Through the production of sphingosine, may also regulate the function of the Golgi complex and regulate the glycosylation of proteins (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains an alternate 3' terminal exon, compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...