Fance (NM_001163820) Mouse Untagged Clone

CAT#: MC216682

Fance (untagged) - Mouse Fanconi anemia, complementation group E (Fance), transcript variant 2, (10ug)



  "NM_001163820" in other vectors (4)

CNY 6,270.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2810451D06Rik; AI415634; AW209126
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216682 representing NM_001163820
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

CTGGCGACGCCGGGGTCGGACTCCGTAGCCTCGGCCGGAGCGGCGCCCTGGGCGAGCCTGGAGGCCCCTG
CCCGCCTCCTGCTTCAGGCGCTACAGGCAGGGCCTGAGGGTGCGCGGCGCGGGCTAGGGGTTCTGCGCGC
CCTCGGCCGCCGCGCGGAGCACTTCCCTTGGGATGGCTTCCTGGAGGCGCTGGGCCACTTAGAGCCCGAG
GTGCGGGGCCCCGACGGCCGCCTAGAGCTGGTCCCACTGTTGCTCCGGCTGCCTGGGGTCTGCCAGAAGA
ACCTGCTGTCCCTGCTGCTGGCTCTCCTACCATCCTTACCTGAAAGCGGACTCCGCTCTGTGCTGCAGCT
CCACCATCAGGATGTGTCCTCTACCACTGATGCCTGGCTCCATGCCCTGGGGGAGCTGCTGCGAAGGGAT
GTGGGGGTTGGAGTCGCTGAGGGATCTTCTCCATTGACCAGAAGCTGTCAGTTACAGCTCCGGGACCTGT
GTGGGCGGCTGGGCCAAGGGGGGAGGGGGCTGAAACTGGCCCTGGCTCCAGATCCTGAACAAGAGGACAG
ACTCTCACAGCTTTGCGGGAAACGGACGAAAGAGCCAGAAGAGGCTGCCAGCCCTGAGTCAGAGAGATCC
CCTAAAAGGTTCCGGGGCTGTGAGGAGGCGGTGGAAGGAAAGGAACCGGAGGAGAGACCCACGCTGGAGT
CGCTGGGATCCCCACCAGATGCAGGAGGCGTGTTGCCTGACACTGACGCCCAGGCTCCGGAGACTGGCCC
TGGCGTGGAGGGTCCCAAGGGTCCCGCTGAGAGTGTGGAGTTGCCCAAAGTTGTCCAGGACCAGGTGCCC
AGGCTGCAGCTGCTGCTGAAGGCCTTCCAGGAGGGGCTGGAGGGTCAGGAGAAGCCCCTAGTGGACCTGC
AGTTTCTTCATGAATGTAGTCCCAGCGAGATGGAGTTGCTATGCAGCGAACTACAGCTACCCCAGCTCCC
TGACGGAGGTCTCCTGCAGCTCTGCAGCCACCTGATGGGTCTCACACCAGCCCTCAGCCTCAGCAATGCC
TCTGTGCTGGCCAGGAGCCTCTTTCTTGACCGGATCCGCTCCCTGCCGTCTTCTGCCTCCAGGCTTCTCA
GAGTGGCCCTCGTCTCCTTCTGTGTAAAGTACACCTACGCCATCTGCAGGGCTGTCCTCTGTCCCTTGCT
CCAGGACCCTCGTGTAGGTCCTGCGCAGACCGAGTTACTGTGTTCCCTCATAAAGGATGAGTCCCTGGAG
TCAGACATGCAGGTCCAGATTTTGGGGCAGGTCCTGGAGCTGGCCTGGCGAGAAGAGACGTTCCTGGTGT
TGCAGACGCTCCTGGAACGGCAGATCACAGAGCAGCAGAGCCTGGACCTGGCTGTGGCCCTAGAGCCCAA
CGCCACCTTCCTGAAGAAGGCCCTGCAAGCAGCGCTGAGACATGTGACCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001163820
Insert Size 1455 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001163820.1, NP_001157292.1
RefSeq Size 1890 bp
RefSeq ORF 1455 bp
Locus ID 72775
Gene Summary This gene encodes the complementation group E subunit of the multimeric Fanconi anemia (FA) nuclear complex composed of proteins encoded by over ten Fanconi anemia complementation (FANC) group genes: FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The FA complex is necessary for protection against DNA damage. This gene product is required for the nuclear accumulation of FANCC and provides a critical bridge between the FA complex and FANCD2. Defects in the related human gene are a cause of Fanconi anemia, a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. Translation of this protein is initiated at a non-AUG (CUG) start codon, which is inferred from the related human gene and the notion that this protein is functionally indispensable. Multiple transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (2) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. The non-AUG start codon (CUG at nt 115) is inferred from the human orthologous gene (GeneID:2178) that encodes a functionally important protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...