Sall4 (NM_201396) Mouse Untagged Clone

CAT#: MC212042

Sall4 (untagged) - Mouse sal-like 4 (Drosophila) (Sall4), transcript variant c, (10ug)



  "NM_201396" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Polyclonal Antibody against Sall4
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5730441M18Rik; AA407717; AL022809; AW536104; C78083; C78563; C330011P20Rik; Tex20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212042 representing NM_201396
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGAGGCGCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGGAGGGCCAGGGCGAGCAGCCTCAGC
AGCTACCGAGCCCCGACCTCGCCGAGGCGCTGGCGGCGGAGGAACCCGGTCGTACCAGCCTCCCTCCAAC
ATTTATCCGAGCACAGCCCACCTTTGTCAAAGTTGAAGTGCCTGGCACCTTTGTGGGACCCCCCAGCATG
CCCTCGGGTATGCCGCCTTTGCTAGCATCGCAGCCGCAGCCACGCCGCCAGGCCAAGCAGCACTGCTGCA
CACGGTGTGGAAAGAACTTCTCGTCTGCCAGTGCCCTGCAGATCCACGAGCGAACACACACGGGAGAGAA
GCCTTTCGTGTGTAACATATGCGGGCGGGCCTTCACCACGAAAGGCAACCTGAAGGTACACTACATGACT
CATGGGGCCAACAATAACTCCGCCCGCCGGGGAAGGAAGCTGGCCATAGAGAACCCCATGGCCGCGCTGA
GTGCTGAGGGAAAGAGAGCGCCCGAGGTGTTTTCCAAGGAGCTCCTGTCCCCCGCGGTGAGTGTGGACCC
CGCCTCCTGGAACCAGTACACCAGCGTCCTGAATGGGGGTCTGGCCATGAAGACCAACGAGATCTCCGTG
ATCCAGAGCGGAGGCATCCCCACGCTGCCTGTGTCGCTGGGGGCCAGCTCTGTGGTGAGCAATGGCACGA
TTTCCAAGCTTGACGGCTCTCAGACCGGTGTGAGCATGCCCATGAGCGGGAACGGAGAAAAGCTCGCTGT
TCCCGACGGCATGGCCAAACACCAGTTCCCTCACTTCCTGGAGGAAAATAAGATTGCTGTCAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_201396
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_201396.3, NP_958798.2
RefSeq Size 2737 bp
RefSeq ORF 837 bp
Locus ID 99377
UniProt ID Q8BX22
Gene Summary This gene belongs to the spalt family of zinc finger transcription factors. In mouse, functions for this gene have been described in many embryonic developmental processes, including brain, heart, and limb development. In addition, this gene is an important pluripotency factor that is required for stem cell maintenance. Homozygous mutant mice display embryonic lethality, while conditional knock-out in embryonic germ cells results in failure to establish a robust stem cell population. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (c) lacks an in-frame exon compared to variant (a). It encodes isoform c, which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...