Cma1 (NM_010780) Mouse Untagged Clone

CAT#: MC208952

Cma1 (untagged) - Mouse chymase 1, mast cell (Cma1), (10ug)



  "NM_010780" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Mcp; Mcp-; Mcp-5; Mcp5; Mcpt; Mcpt5; MMCP-; MMCP-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208952 representing NM_010780
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCCTGCAGCAGCCCTGAGGAGGCCCTCTGAGAGGATGCATCTTCTTACTCTTCATCTGCTGCTCC
TTCTCCTGGGTTCCAGCACCAAAGCTGGAGAGATCATTGGAGGCACGGAGTGCATACCACACTCCCGCCC
CTACATGGCCTATCTGGAAATTGTCACTTCTGAGAACTACCTGTCGGCCTGCAGTGGCTTCCTGATAAGA
AGAAACTTTGTGCTGACTGCAGCTCACTGTGCGGGAAGGTCTATAACAGTCCTCCTAGGAGCCCATAACA
AAACATCTAAAGAAGACACGTGGCAGAAGCTTGAGGTGGAAAAGCAATTCCTTCATCCAAAATATGATGA
GAATTTGGTTGTCCACGACATCATGCTACTGAAGTTGAAGGAGAAAGCCAAGCTAACCCTAGGTGTGGGA
ACCCTCCCACTCTCTGCCAACTTCAACTTTATCCCACCCGGGAGAATGTGCAGGGCAGTTGGCTGGGGCA
GAACAAACGTGAATGAGCCAGCCTCCGACACACTGCAGGAAGTAAAGATGAGACTCCAGGAGCCCCAAGC
CTGCAAACACTTCACCAGTTTTCGACACAATTCCCAGCTGTGTGTGGGCAACCCCAAGAAGATGCAAAAT
GTATACAAGGGAGACTCTGGAGGACCTCTGCTGTGTGCTGGGATAGCCCAAGGCATTGCATCCTATGTAC
ATCGGAATGCAAAGCCCCCTGCTGTCTTTACCAGAATCTCCCATTACAGGCCCTGGATCAATAAGATCTT
GAGGGAGAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010780
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_010780.3, NP_034910.2
RefSeq Size 1090 bp
RefSeq ORF 744 bp
Locus ID 17228
UniProt ID P21844
Gene Summary This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...