Ccsap (NM_028536) Mouse Untagged Clone

CAT#: MC207732

Ccsap (untagged) - Mouse RIKEN cDNA 1700054N08 gene (1700054N08Rik), (10ug)



  "NM_028536" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700054N08Rik; AI853424
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207732 representing NM_028536
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCCGGGCAGCGGGGTGAAGAGCGAGTATATGAAGCGCTATCGGGAGCCGCGCTGGGACGAATACG
CGCCGTGCTACCGCGAGCTGCTGCGCTACCGCCTGGGCCGCCGGCTGCTGGAGCAAGCGCACGCGCCCTG
GCTCTGGGACGCCTGGGGCCCGGACAGCCCCTCGGACAGCTCGGCTTCACCCAGTCCGGCCCCCAGGGGC
GCGTTAGGGGAGCCCTCGGCGCCCTCCGCGCGGGAGGAGGAGCAGCCGGTGGGGGAGCGCGGCGCGGAGC
TGCGGGACGCGGAGGAGCAGGACACAGTGTTACCAGCACCACCAAAAAAGGACACGGAAGAGAAACCCGA
AGAACACAAGACAAAAGAGACTGATGGGGCACCCAGTGGCCCTGGACCGCGGCAACAGCCTAGTGCCTTA
TGTGCCAGAGGAAGTAAGAAAGCCACCAGAAGCCCACAGAGATCGACGAGCAAGATAAAAGAGAACAAGC
ACCCGTTTGCTCTTTATGGCTGGGGAGAGAGACAGATGGACATGGGAAGCCAGAAGACACACAACGTCTG
CGCGTCAGCCTCTGTGCACGAGATTCATGAATCAGCACTTCGAGCCAAGAATAGAAGACAGGTGGAGAAA
AGGAAGCTGGCTGCCCAGAGGCAGCGGGCTCACTCGGTGGACGTGGAAAAGAACCAGAGGGTAAAGCCGG
CGTCTGCCGAGAACCCATGGCTGACAGAGTATATGCGGTGCTACTCAGCGAGGGCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_028536
Insert Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_028536.1, NP_082812.1
RefSeq Size 2719 bp
RefSeq ORF 759 bp
Locus ID 73420
UniProt ID Q8QZT2
Gene Summary Plays a role in microtubule (MT) stabilization and this stabilization involves the maintenance of NUMA1 at the spindle poles. Colocalizes with polyglutamylated MTs to promote MT stabilization and regulate bipolar spindle formation in mitosis. Binding of CCSAP to centrosomes and the spindle around centrosomes during mitosis inhibits MT depolymerization, thereby stabilizing the mitotic spindle. May play a role in embryonic development. May be required for proper cilia beating (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...