1500034J01Rik (BC093523) Mouse Untagged Clone
CAT#: MC206903
1500034J01Rik (untagged) - Mouse RIKEN cDNA 1500034J01 gene (cDNA clone MGC:103301 IMAGE:3711509), (10ug)
CNY 3,230.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1500034J01Rik; 1700095J19Rik; R74921 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206903 representing BC093523.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGACTTTCTGAAAGGCTTGCCCGTCTACAACAAGAGCAACTTCAGCAGGTTCCACGCGGACTCT GTGTGCAAGGCCTCGAACCGCCGTCCCTCAGTATACCTGCCGACCCGAGAGTACCCGTCAGAACAGATC ATTGTGACAGAAAAGACGAACATACTTCTGCGGTACCTGCACCAGCAATGGGATAAAAAGAATGCTGCC AAGAAGAGAGACCAAGAGCAGGTGGAGGCGGAGGGCGAGAGCTCAGCGCCACCTCGCAAGGTGGCCCGG ACCGACAGCCCCGACATGCCGGAGGACACCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC093523 |
Insert Size | 309 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC093523 |
RefSeq Size | 1897 bp |
RefSeq ORF | 308 bp |
Locus ID | 66498 |
MW | 11.8 kDa |
Gene Summary | May be involved in ubiquitination and subsequent proteasomal degradation of target proteins. Component of the DDD-E2 complexes which may provide a platform for interaction with CUL4A and WD repeat proteins (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200329 | 1500034J01Rik (tGFP-tagged) - Mouse RIKEN cDNA 1500034J01 gene (cDNA clone MGC:103301 IMAGE:3711509) |
CNY 2,850.00 |
|
MR200329 | 1500034J01Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1500034J01 gene (cDNA clone MGC:103301 IMAGE:3711509) |
CNY 1,200.00 |
|
MR200329L3 | Lenti ORF clone of 1500034J01Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1500034J01 gene (cDNA clone MGC:103301 IMAGE:3711509) |
CNY 4,750.00 |
|
MR200329L4 | Lenti ORF clone of 1500034J01Rik (mGFP-tagged) - Mouse RIKEN cDNA 1500034J01 gene (cDNA clone MGC:103301 IMAGE:3711509) |
CNY 4,750.00 |
其它1500034J01Rik产品