0610038F07Rik (BC060090) Mouse Untagged Clone

CAT#: MC206891

0610038F07Rik (untagged) - Mouse RIKEN cDNA 0610038F07 gene (cDNA clone MGC:61338 IMAGE:5698361), (10ug)



  "BC060090" in other vectors (4)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SDHAF2 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MGC61338
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC206891 representing BC060090.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGTGGTCACCTTGATCCCGACGCTGGCGCGGGCACTGTCAAAGCACAGTCTGCTGTCTCCCTTG
CCTAGTGTGACATCATTCAGACGCTTCTACAGAGGTGACAGCCCAACAGACTCTCAAAAAGACATGATT
GAAATCCCTTTGCCTCCGTGGCAGGAGAGAACTGATGAATCCATAGAAACCAAAAGAGCCCGCTTACTC
TATGAGAGCAGAAAGAGGGGGATGCTGGAGAACTGCATTCTCCTTAGCCTGTTTGCTAAAGAGTATCTG
CACAACATGACAGAGAAGCAGCTGAACCTCTATGATCGCCTGATTAACGAGCCTAGCAATGACTGGGAT
ATTTACTACTGGGCCACAGGTATGCCATATGCTGAGCTGCATCTTGGGATAATACGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN BC060090
Insert Size 405 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC060090
RefSeq Size 3993 bp
RefSeq ORF 404 bp
Locus ID 66072
MW 15.7 kDa
Gene Summary Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol. Required for flavinylation (covalent attachment of FAD) of the flavoprotein subunit SDHA of the SDH catalytic dimer.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...