Pdlim4 (NM_019417) Mouse Untagged Clone

CAT#: MC204696

Pdlim4 (untagged) - Mouse PDZ and LIM domain 4 (Pdlim4), (10ug)



  "NM_019417" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ril
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC030068
AGCTCCGGCCCGCGATGACCCACTCGGTGACCCTGCGCGGCCCTTCACCCTGGGGCTTCCGCCTGGTGGG CGGCCGGGACTTCAGTGCTCCCCTCACCATCTCGCGGGTTCATGCTGGGAGCAAAGCGGCCCTGGCTGCC CTGTGCCCAGGTGACTTGATCCAAGCCATCAACGGCGAGAGCACTGAGCTCATGACACACCTGGAGGCCC AGAACCGCATTAAAGGCTGCCACGATCATCTTACGCTCTCGGTCAGCAGGCCTGAGAATAAGAACTGGCC CAGTGCTCCTGATGACAAGGCTCAAGCACATAGGATCCACATTGACCCTGAGTCCCAGGACTGCAGTCCA GCCACCAGCAGGCGCTCCTCAGTCTCTGGGATTAGTCTGGAGGACAACAGATCGGGCCTGGGATCTCCAT ATGGTCAGCCACCTCGCCTTCCAGTCCCTCACAATGGCAGCAGCAACGAGGCCACCCTGCCAGCCCAGAT GAGCGCTCTGCATGTGTCTCCACCCACCAGTGCCGACACAGCCAGGGTTCTCCCTCGGAACCGGGACTGC AGGGTAGACCTGGGTTCAGAGGTATACAGGATGTTAAGGGAGCCAGCAGAGCCCACAGCCTCGGAGCCGA AACAGTCAGGATCCTTCCGCTACCTGCAGGGCATGCTAGAGGCTGGCGAGGGCGGGGATCGGCCTGGGTC TGGTGGTCCCCGGAACCTCAAACCAGCAGCCAGCAAGCTCGGTGCTCCACTGAGTGGCCTGCAGGGGCTA CCAGAGTGCACGCGCTGCGGCCACGGGATCGTGGGAACCATTGTCAAGGCGAGAGACAAGCTCTACCATC CGGAGTGCTTCATGTGCAGCGACTGCGGCCTGAATCTCAAACAGCGTGGGTACTTCTTCCTAGATGAACG GCTGTACTGTGAGAATCACGCCAAGGCTCGAGTCAAGCCGCCGGAGGGATATGATGTGGTGGCTGTATAC CCCAATGCTAAGGTGGAACTTGTCTGAGCTGGAAAATCTTGTCTTGCCTCTGCTTCACTTAATGTTCCCT CATGGCCTGTGTAAATATATGTCCTCCTGGCCTTTCTAATAAAGTCCTTCTGCTTGCTCTGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_019417
Insert Size 993 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC030068, AAH30068
RefSeq Size 1143 bp
RefSeq ORF 993 bp
Locus ID 30794
UniProt ID P70271
Gene Summary Suppresses SRC activation by recognizing and binding to active SRC and facilitating PTPN13-mediated dephosphorylation of SRC 'Tyr-419' leading to its inactivation. Inactivated SRC dissociates from this protein allowing the initiation of a new SRC inactivation cycle. Involved in reorganization of the actin cytoskeleton (By similarity). In nonmuscle cells, binds to ACTN1 (alpha-actinin-1), increases the affinity of ACTN1 to F-actin (filamentous actin), and promotes formation of actin stress fibers. Involved in regulation of the synaptic AMPA receptor transport in dendritic spines of hippocampal pyramidal neurons directing the receptors toward an insertion at the postsynaptic membrane. Links endosomal surface-internalized GRIA1-containing AMPA receptors to the alpha-actinin/actin cytoskeleton. Increases AMPA receptor-mediated excitatory postsynaptic currents in neurons (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...