Nmb (NM_026523) Mouse Untagged Clone
CAT#: MC204682
Nmb (untagged) - Mouse neuromedin B (Nmb), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 3110023K12Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC028490
AGAGCCTGTTTGGCACAGCCATGACCCGGCAAGCAGGGAGCTCTTGGCTCCTCCGTGGTCTCCTGCTCTT CGCATTGTTCGCTTCCGGCGTCGCTCCCTTCAACTGGGATCTCCCGGAGCCCCGCAGCCGAGCAAGCAAG ATTCGAGTGCACCCTCGGGGCAACCTCTGGGCGACCGGTCACTTCATGGGCAAGAAGAGCCTGGAACCCC CGAGCCTGTCACTGGTGGGGACAGCACCCCCTAACACCCCGAGGGACCAGAGACTACAGCTGAGTCATGA TCTGCTCAGGATCCTCCTGCGAAAGAAAGCTCTAGGCATGAACTTCAGTGGCCCAGCTCCCCCAATCCAG TACAGGAGGCTGCTGGAGCCACTACTGCAGAAGTGATGCCAATAATGGAACAAACCGGATGCTGGGCTTA GAATGTGTCCATCCAGGGAAGCTGACAATGGAACCCTAGCAGTGGCCTCCTCTGGATGTAAATCCTAAGC TCAAATGTGTTAATCTGTTACTGTGATTTCTGGTTGGGTCACCAGGAATGTTAATGATGCAGACACAAAG TCTTTCCTGCTGTATTTCTTGCTTCCCTGGTGAAGTGGTGAATAAAAATACTGCTCTTTAAAAAAAAAAA AAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_026523 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC028490, AAH28490 |
RefSeq Size | 641 bp |
RefSeq ORF | 366 bp |
Locus ID | 68039 |
UniProt ID | Q9CR53 |
Gene Summary | This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in satiety, reproduction and thermoregulation, as well as in stress, fear and other behavioral responses. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2016] Transcript Variant: This variant (2) uses an alternate splice junction at the 5' end of the last exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200598 | Nmb (tGFP-tagged) - Mouse neuromedin B (Nmb) |
CNY 2,850.00 |
|
MR200598 | Nmb (Myc-DDK-tagged) - Mouse neuromedin B (Nmb) |
CNY 1,200.00 |
|
MR200598L3 | Lenti ORF clone of Nmb (Myc-DDK-tagged) - Mouse neuromedin B (Nmb) |
CNY 4,750.00 |
|
MR200598L4 | Lenti ORF clone of Nmb (mGFP-tagged) - Mouse neuromedin B (Nmb) |
CNY 4,750.00 |