United States
Germany
Japan
United Kingdom
China
Eny2 (NM_175009) Mouse Untagged Clone
CAT＃: MC202310
Eny2 (untagged) - Mouse enhancer of yellow 2 homolog (Drosophila) (Eny2), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1810057B09Rik; 6720481I12; DC6; Ey2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC048361 sequence for NM_175009
GTAGCTTTCTGTGTGCTTAGGTGCCCGAGCTACTGAGGGTCTAAGTCCGGGCAGCCGAAGAGTGTGGTAG GTAACGGTCGTCAGCGCAAGGGTCATTTCGTCGCTGGGAAGGGACGGCCCTCGCCCGCGGTGATGGTGGT TAGCAAGATGAACAAAGATGCGCAGATGAGAGCAGCGATTAACCAAAAGTTAATAGAAACTGGAGAAAGA GAACGCCTCAAAGAGTTGCTGAGAGCTAAATTAATTGAGTGCGGCTGGAAGGATCAGCTAAAGGCACACT GTAAAGAGGTAATTAAAGAAAAAGGACTAGAACACGTTACTGTTGATGACTTGGTGGCTGAAATCACTCC AAAAGGCAGAGCCCTGGTACCTGACAGTGTAAAGAAGGAGCTCCTACAGAGAATAAGAACATTCCTTGCT CAGCATGCCAGTCTTTAAGGGTGAATTAGAATGTGTTGGTCTGTGGATTTATTTCTGAAAGTAAAACTTG CCATAATTAGAAATTGATTTCCCAAATAAAGTCCTTTTTTGTATGATGGTATACAGTTTTCAGTAATGTA TACATTGTATTGATTTTTTCCCTAAATGTGTTATTTTAATAAATATCTCATGAATGAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_175009 |
| Insert Size | 306 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC048361, AAH48361 |
| RefSeq Size | 647 bp |
| RefSeq ORF | 306 bp |
| Locus ID | 223527 |
| UniProt ID | Q9JIX0 |
| Gene Summary | Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates in a subcomplex that specifically deubiquitinates both histones H2A and H2B. The SAGA complex is recruited to specific gene promoters by activators such as MYC, where it is required for transcription. Required for nuclear receptor-mediated transactivation. As a component of the TREX-2 complex, involved in the export of mRNAs to the cytoplasm through the nuclear pores (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200314 | Eny2 (tGFP-tagged) - Mouse enhancer of yellow 2 homolog (Drosophila) (Eny2) |
CNY 2,850.00 |
|
| MR200314 | Eny2 (Myc-DDK-tagged) - Mouse enhancer of yellow 2 homolog (Drosophila) (Eny2) |
CNY 1,200.00 |
|
| MR200314L3 | Lenti ORF clone of Eny2 (Myc-DDK-tagged) - Mouse enhancer of yellow 2 homolog (Drosophila) (Eny2) |
CNY 4,750.00 |
|
| MR200314L4 | Lenti ORF clone of Eny2 (mGFP-tagged) - Mouse enhancer of yellow 2 homolog (Drosophila) (Eny2) |
CNY 4,750.00 |
