Folr2 (NM_008035) Mouse Untagged Clone
CAT#: MC201960
Folr2 (untagged) - Mouse folate receptor 2 (fetal) (Folr2), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | FBP; FBP2; Fol; Folb; Folbp-2; Folbp2; FR-; FR-beta; FR-P3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC022108 sequence for NM_008035
AAAGCTTCTATGTGGGGCTGTGGACGAAGACTGTAGAGACTACCCAGAGTCTGACCTAGGGAGAGGCCAA CTCGGATACCCCTATGTGCGCTCCCAGAAGCTAAGGACATTGAGACAGAAAGACATGGCCTGGAAACAGA CACCACTCTTGCTTTTGGTCTACATGGTCACAACAGGCAGTGGCCGGGACAGAACAGACCTACTCAACGT TTGCATGGATGCCAAACACCATAAGACAAAGCCGGGCCCCGAGGACAAGCTGCATGACCAGTGTAGTCCA TGGAAGAAAAATGCCTGTTGCTCAGTCAACACCAGCCAGGAGCTACACAAGGCTGACTCCCGTCTGTACT TCAACTGGGATCACTGTGGCAAGATGGAGCCTGCCTGTAAGAGTCACTTCATCCAAGACTCCTGCCTGTA TGAGTGCTCCCCCAACCTTGGGCCTTGGATCCAGCAAGTGGACCAGAGTTGGCGTAAAGAGCGTTTCCTG GATGTGCCCTTATGCAAAGAGGACTGTCACCAGTGGTGGGAAGCCTGTCGTACCTCCTTTACCTGCAAGA GAGACTGGCATAAAGGCTGGGACTGGTCCTCAGGCATTAACAAGTGCCCAAACACAGCACCCTGTCACAC GTTTGAGTACTACTTCCCGACACCAGCCAGCCTTTGCGAGGGTCTCTGGAGTCACTCCTACAAGGTCAGC AACTACAGCAGAGGGAGTGGCCGCTGCATCCAGATGTGGTTTGACTCAACCCAGGGCAATCCCAATGAGG ACGTGGTGAAGTTTTATGCTTCCTTTATGACATCTGGGACTGTGCCCCATGCAGCAGTACTTCTTGTGCC CAGCCTGGCCCCAGTGCTGTCATTATGGCTCCCTGGCTGAGAGGTCAGTCTTCCTCTCTAGATTTCTCCT CTATCTACCCTTGGTCTGGTTCAACTCTTCAAAGAATAAGGAAGTCTTGAGCCTGCTTCCACCCCTCTCC TCTGTCATCCAGTTCCTGATCCATGTTGGGGGTTGGGGTTTCTACAATCATTTTCAATAAATCTATGACA CATCTGGAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008035 |
Insert Size | 756 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC022108, AAH22108 |
RefSeq Size | 1072 bp |
RefSeq ORF | 756 bp |
Locus ID | 14276 |
UniProt ID | Q05685 |
Gene Summary | This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants (1-3) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203207 | Folr2 (tGFP-tagged) - Mouse folate receptor 2 (fetal) (Folr2) |
CNY 4,000.00 |
|
MR203207 | Folr2 (Myc-DDK-tagged) - Mouse folate receptor 2 (fetal) (Folr2) |
CNY 2,400.00 |
|
MR203207L3 | Lenti ORF clone of Folr2 (Myc-DDK-tagged) - Mouse folate receptor 2 (fetal) (Folr2) |
CNY 4,750.00 |
|
MR203207L4 | Lenti ORF clone of Folr2 (mGFP-tagged) - Mouse folate receptor 2 (fetal) (Folr2) |
CNY 4,800.00 |