Clpp (NM_017393) Mouse Untagged Clone

CAT#: MC200057

Clpp (untagged) - Mouse caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (Clpp), (10ug)



  "NM_017393" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AU019820; D17Wsu160e
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC001998 sequence for NM_017393
GCCAAGCCGGAGTGCGCGTCGTCATGTGGCCCAGAGTGCTGCTGGGGGAGGCCCGGGTGGCTGTGGACGG ATGTCGCGCTCTGTTGTCTCGCCTTGCCGTGCATTTCTCCCCGCCATGGACTGCTGTGAGCTGCTCACCC CTGCGGAGGAGCCTGCATGGAACTGCGACGCGAGCTTTCCCGCTCATCCCCATAGTGGTGGAGCAGACGG GTCGAGGCGAGCGCGCTTATGACATATACTCGAGGCTGTTGCGGGAACGCATCGTGTGCGTCATGGGCCC GATTGACGACAGTGTGGCCAGTCTGGTCATTGCCCAGCTGTTGTTCTTACAGTCTGAAAGCAACAAGAAG CCCATTCATATGTATATCAACAGCCCAGGTGGTGTGGTAACTGCGGGCCTGGCCATCTACGACACAATGC AGTACATCCTGAACCCCATCTGCACGTGGTGTGTTGGACAGGCTGCCAGCATGGGCTCCCTGCTCCTCGC TGCTGGCAGCCCGGGCATGCGCCATTCACTGCCCAATTCCAGAATCATGATCCACCAGCCCTCTGGAGGA GCCAGGGGCCAAGCCACAGACATCGCCATCCAGGCAGAGGAAATCATGAAGCTGAAAAAGCAGCTATACA ACATCTACGCCAAACACACCAAGCAGAGCCTACAGGTGATCGAGTCAGCAATGGAGAGGGACCGCTACAT GAGCCCCATGGAGGCCCAAGAGTTTGGCATCTTGGACAAGGTCTTGGTCCACCCACCTCAGGACGGGGAG GATGAGCCAGAACTGGTACAGAAGGAGACTGCCACAGCGCCGACGGATCCTCCTGCCCCGACAAGCACCT AAGGAGTGGAGACCAGACTGAAACTTCCTCTGCTGGGCCCAAGAACAACCCCTAGAGGAGATGTGGATTG AGGTTGCCCTCAGAGCAGGGCAGACTGCCTGAGACACTGTGATTTAAATTAAATCTTTGTAGTCTTTGTC CCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_017393
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC001998, AAH01998
RefSeq Size 997 bp
RefSeq ORF 819 bp
Locus ID 53895
UniProt ID O88696
Gene Summary Protease component of the Clp complex that cleaves peptides and various proteins in an ATP-dependent process. Has low peptidase activity in the absence of CLPX. The Clp complex can degrade CSN1S1, CSN2 and CSN3, as well as synthetic peptides (in vitro) and may be responsible for a fairly general and central housekeeping function rather than for the degradation of specific substrates (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...