Clpp (NM_017393) Mouse Untagged Clone
CAT#: MC200057
Clpp (untagged) - Mouse caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (Clpp), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AU019820; D17Wsu160e |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC001998 sequence for NM_017393
GCCAAGCCGGAGTGCGCGTCGTCATGTGGCCCAGAGTGCTGCTGGGGGAGGCCCGGGTGGCTGTGGACGG ATGTCGCGCTCTGTTGTCTCGCCTTGCCGTGCATTTCTCCCCGCCATGGACTGCTGTGAGCTGCTCACCC CTGCGGAGGAGCCTGCATGGAACTGCGACGCGAGCTTTCCCGCTCATCCCCATAGTGGTGGAGCAGACGG GTCGAGGCGAGCGCGCTTATGACATATACTCGAGGCTGTTGCGGGAACGCATCGTGTGCGTCATGGGCCC GATTGACGACAGTGTGGCCAGTCTGGTCATTGCCCAGCTGTTGTTCTTACAGTCTGAAAGCAACAAGAAG CCCATTCATATGTATATCAACAGCCCAGGTGGTGTGGTAACTGCGGGCCTGGCCATCTACGACACAATGC AGTACATCCTGAACCCCATCTGCACGTGGTGTGTTGGACAGGCTGCCAGCATGGGCTCCCTGCTCCTCGC TGCTGGCAGCCCGGGCATGCGCCATTCACTGCCCAATTCCAGAATCATGATCCACCAGCCCTCTGGAGGA GCCAGGGGCCAAGCCACAGACATCGCCATCCAGGCAGAGGAAATCATGAAGCTGAAAAAGCAGCTATACA ACATCTACGCCAAACACACCAAGCAGAGCCTACAGGTGATCGAGTCAGCAATGGAGAGGGACCGCTACAT GAGCCCCATGGAGGCCCAAGAGTTTGGCATCTTGGACAAGGTCTTGGTCCACCCACCTCAGGACGGGGAG GATGAGCCAGAACTGGTACAGAAGGAGACTGCCACAGCGCCGACGGATCCTCCTGCCCCGACAAGCACCT AAGGAGTGGAGACCAGACTGAAACTTCCTCTGCTGGGCCCAAGAACAACCCCTAGAGGAGATGTGGATTG AGGTTGCCCTCAGAGCAGGGCAGACTGCCTGAGACACTGTGATTTAAATTAAATCTTTGTAGTCTTTGTC CCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_017393 |
Insert Size | 819 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC001998, AAH01998 |
RefSeq Size | 997 bp |
RefSeq ORF | 819 bp |
Locus ID | 53895 |
UniProt ID | O88696 |
Gene Summary | Protease component of the Clp complex that cleaves peptides and various proteins in an ATP-dependent process. Has low peptidase activity in the absence of CLPX. The Clp complex can degrade CSN1S1, CSN2 and CSN3, as well as synthetic peptides (in vitro) and may be responsible for a fairly general and central housekeeping function rather than for the degradation of specific substrates (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203637 | Clpp (tGFP-tagged) - Mouse caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (Clpp) |
CNY 2,850.00 |
|
MR203637 | Clpp (Myc-DDK-tagged) - Mouse caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (Clpp) |
CNY 2,400.00 |
|
MR203637L3 | Lenti ORF clone of Clpp (Myc-DDK-tagged) - Mouse caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (Clpp) |
CNY 4,750.00 |
|
MR203637L4 | Lenti ORF clone of Clpp (mGFP-tagged) - Mouse caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) (Clpp) |
CNY 4,750.00 |