NALP12 (NLRP12) (NM_144687) Human 3' UTR Clone

CAT#: SC206277

3' UTR clone of NLR family pyrin domain containing 12 (NLRP12) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NALP12 (NLRP12) (NM_144687) Human 3' UTR Clone
Vector pMirTarget
Synonyms CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
ACCN NM_144687
Insert Size 338 bp
Sequence Data
>SC206277 3’UTR clone of NM_144687
The sequence shown below is from the reference sequence of NM_144687. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACAAAACCTTATTTGGACATTGGCTGCTGAATGGTCCTATCTGCTGGCTCTCCCCTGAGATCTGGACAG
AGGAAGATGGGAGGGTGCTCATCACCCCCCCAGCATAATGATCAGCCTCCTTCCTAGAGACAGACTCAT
GCAGATTGAGATCAAAAGTCCCTCTGCTTGGGATCAAATTAATGTTTGACAGAGCTGGCCAGGCGTGGT
GGCTCATGTATGTAATCCTAGCACTTCGAGAGGCCGAGGCAGGTGGATCACGAGGTCAGGAGTTTGAGA
TTAGCCTGGCCAAGATGGTGAAACCCTGTCTCTACTAAAAATAAAAAAAAATTAGCCAGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_144687.4
Synonyms CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
Summary This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Locus ID 91662
MW 12.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...