Carboxylesterase 7 (CES5A) (NM_001143685) Human 3' UTR Clone

CAT#: SC205469

3' UTR clone of carboxylesterase 7 (CES7) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Carboxylesterase 7 (CES5A) (NM_001143685) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAUXIN; CES4C1; CES5; CES7; HEL126
ACCN NM_001143685
Insert Size 327 bp
Sequence Data
>SC205469 3’UTR clone of NM_001143685
The sequence shown below is from the reference sequence of NM_001143685. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCCTTTCTTTTTCTTTTGTGCTCCTTGAGAAGTTATCTTTCTGTGATTTTGGTTTCCCTTCTCCTCC
CATAATTTCTCCCGCAATCATTAGCTTCTTTCTGAGCTCAGCTGCTTTCTATGGGGATCCTTGCAAAAC
AAGCTGCTTTCGCTGATATTTTATGGACTTAGGAATGATCCTTACAGAATTCTTTTCAACATCAAAAAG
TGCAATTTGTCTTGGAAGGCAACAAGATTTCTTCAATAAATTTGGAAGAGGGCTGGCCTATTAGTTGTC
ATAATAATGGTTTTGTAACTCATATGAAATAAAATCAGAATGTAAAATAGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001143685.2
Synonyms CAUXIN; CES4C1; CES5; CES7; HEL126
Summary This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Locus ID 221223
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...