CLK2 (NM_003993) Human 3' UTR Clone

CAT#: SC205234

3' UTR clone of CDC-like kinase 2 (CLK2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CLK2 (NM_003993) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_003993
Insert Size 380 bp
Sequence Data
>SC205234 3’UTR clone of NM_003993
The sequence shown below is from the reference sequence of NM_003993. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGACTCCAGTCGGGATATCAGTCGGTGACGATCAGGCCCTGGGCCCCCCTGCATCTTTTATAGCAGT
GGGTGTCCAGTCCAGGACACTGGTGCTTTTTTATACAAGAGAACGAGCCAGAGTTCACTCCTTCCTCCT
GGCTCTCTATATACCTGTGAATATGTGAAATAGTGTAAATATGAAAGAACTTGTACCTATCACTTCAAC
CCCTGCCTTGTACATAATACTATTCCATCCACACAGTTTCCACCCTCACCTGCCCCCTCATACGGAGTT
GGATGGGGGCCGAGTGAGGTAACCAGGTGGCATCTACCCCATGTTTTATAAGGAATTTTGTACAGTCTT
TGTGAAATAAAATAACGTGCTTCATTTGACCCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003993.4
Summary This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Locus ID 1196
MW 14.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...