RAB34 (NM_001142625) Human 3' UTR Clone

CAT#: SC204074

3' UTR clone of RAB34 member RAS oncogene family (RAB34) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RAB34 (NM_001142625) Human 3' UTR Clone
Vector pMirTarget
Synonyms NARR; RAB39; RAH
ACCN NM_001142625
Insert Size 340 bp
Sequence Data
>SC204074 3’UTR clone of NM_001142625
The sequence shown below is from the reference sequence of NM_001142625. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGTGCCACCCTCATTCCTCCAGAGCTTGACCCCTGGACATTTGCACTGACTTTATCCAGACCAAAGAG
CTGCCTCTTGGTGGCAGTATTCCCACAGAGGGGTAGCTGGGATCATGCTAGTCACTTCCTGCCCCCAGG
CACCGTGCCAAAGACTGGATGCCCCCTACTCCTCAGGGGACTGTCCAGGGCGCCCAGTGGTAGTGAGGG
AGAGTGTCTCTGTTCTTTTGCTCAGCCTGCTGGGCCCTTTGTGTTTGAGGATGCTTAATGATTCCAGCC
TCTCACTGTGCCTTATGCATTAAAATTTCTTTGTTACGAGCACTTAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001142625.2
Synonyms NARR; RAB39; RAH
Summary This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Locus ID 83871
MW 12.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...