NDUFAB1 (NM_005003) Human 3' UTR Clone

CAT#: SC203991

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha/beta subcomplex1 8kDa (NDUFAB1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NDUFAB1 (NM_005003) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACP; ACP1; FASN2A; SDAP
ACCN NM_005003
Insert Size 198 bp
Sequence Data
>SC203991 3’UTR clone of NM_005003
The sequence shown below is from the reference sequence of NM_005003. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTGCAGATAAGAAGGATGTATATGAATAAAGTATCAGACCCTTTGGCTTTGCTGAGAGAGGACTCAGA
TGATAGTGACGAATGTCTGGCAGTGAGGACACATTTTGGCATTCTTGCTGACTCTGACAGAGTGATTCT
GATGGACTTGTATTTAAATTGTATGTGTTTTACTCTTTGAAAATAAATCTATAAAACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005003.3
Synonyms ACP; ACP1; FASN2A; SDAP
Summary Carrier of the growing fatty acid chain in fatty acid biosynthesis (By similarity). Accessory and non-catalytic subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain (PubMed:27626371).[UniProtKB/Swiss-Prot Function]
Locus ID 4706
MW 7.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...