BEX2 (NM_032621) Human 3' UTR Clone

CAT#: SC203247

3' UTR clone of brain expressed X-linked 2 (BEX2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BEX2 (NM_032621) Human 3' UTR Clone
Vector pMirTarget
Synonyms BEX1; DJ79P11.1
ACCN NM_032621
Insert Size 274 bp
Sequence Data
>SC203247 3’UTR clone of NM_032621
The sequence shown below is from the reference sequence of NM_032621. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATCACGATGAGTTTTGCCTTATGCCCTGAATCCTGATGGTTTCCCTGAAGTTAATAGGGAGACCCCTG
CTTCCTAAACTTACACATTTGTGGTGTACCTTTGTCGTAAACGTTTTGATGTTACCTATTTCTTGTGGG
TCTCCTATTACCAGCTTCTAAATGAATGTTGTTTTTGACCCAGTTTGTAAGTTTCTGTCAGCAGGAGAG
TTTTACCTATTGCATGGAAAGATGCTCATTATATATTGTGAAGTTAATAAAACAGTTTTAAAAAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032621.4
Synonyms BEX1; DJ79P11.1
Summary This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Locus ID 84707
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...