CPT1A (NM_001031847) Human 3' UTR Clone

CAT#: SC202748

3' UTR clone of carnitine palmitoyltransferase 1A (liver) (CPT1A) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CPT1A (NM_001031847) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPT1; CPT1-L; L-CPT1
ACCN NM_001031847
Insert Size 226 bp
Sequence Data
>SC202748 3’UTR clone of NM_001031847
The sequence shown below is from the reference sequence of NM_001031847. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAAGTCAAGGACCAAGTTCAGATACTTGAGACAAAGTGGAAAGTCTCAGCATATGGAAACAAGGCCTT
GGAGGAGACCATGGACATCACCAAGTTCATGTGCTGGGCTGGAAAGAAAAGCCTGTTGATTTTCACTTG
CTGTGCATTTATTCATCCATTCCATTGCCTCAATGCTGAGAACAGTGCCTGACACATAAAAGATGCTCA
ATAAATATGTTAAAAGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001031847.3
Synonyms CPT1; CPT1-L; L-CPT1
Summary The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 1374
MW 8.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...