ABL2 (NM_001136001) Human 3' UTR Clone

CAT#: SC202641

3' UTR clone of v-abl Abelson murine leukemia viral oncogene homolog 2 (arg Abelson-related gene) (ABL2) transcript variant e for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ABL2 (NM_001136001) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABLL; ARG
ACCN NM_001136001
Insert Size 254 bp
Sequence Data
>SC202641 3’UTR clone of NM_001136001
The sequence shown below is from the reference sequence of NM_001136001. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGTGCCAATCAGACGTGCATAACATTGTGAACCAAAAGACACAGAGCAGGATGATGCTAGCAACGTATT
CATAGTAACTCCAAACTGGAAACAACCTAAACATCCATCAAGAGGAGAACAGGTGGATTGTGGTATATT
CACACGTTGGCATGCTACACAGCAATGAGAACCCCTGCCACATGCAGCAGCGTGGACGAATCTACACAC
ATGATACTGGGCGAAAGAAGCCAGACAAAAGAGTACATACTTTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001136001.2
Synonyms ABLL; ARG
Summary This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Locus ID 27
MW 9.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...