AHI1 (NM_001134832) Human 3' UTR Clone

CAT#: SC202460

3' UTR clone of Abelson helper integration site 1 (AHI1) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AHI1 (NM_001134832) Human 3' UTR Clone
Vector pMirTarget
Synonyms AHI-1; dJ71N10.1; JBTS3; ORF1
ACCN NM_001134832
Insert Size 227 bp
Sequence Data
>SC202460 3’UTR clone of NM_001134832
The sequence shown below is from the reference sequence of NM_001134832. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACATGTATATTATGGTGGAAAAAGCACTAGACTCAGGGTCAGCCAGCCAGAAGAACTGAGCCGACCTGG
GATCCCACCACTTCCTAACTGTTTTGTTAGGTAGTTCACTTTCTCTCTTCGGATAAATGTCTCCACATT
TCCTACTTCATAGAATTGTCAGAATCAACACAATACATTTAATACTTTGAAACTCATAAAATATTGGGA
GAATAAACAGTATGAGGTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001134832.2
Synonyms AHI-1; dJ71N10.1; JBTS3; ORF1
Summary This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Locus ID 54806
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...