Serum Amyloid P (APCS) (NM_001639) Human 3' UTR Clone

CAT#: SC202080

3' UTR clone of amyloid P component serum (APCS) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Serum Amyloid P (APCS) (NM_001639) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL-S-92n; PTX2; SAP
ACCN NM_001639
Insert Size 187 bp
Sequence Data
>SC202080 3’UTR clone of NM_001639
The sequence shown below is from the reference sequence of NM_001639. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCATCATCAAACCCTTGGTGTGGGTCTGAGGTCTTGACTCAACGAGAGCACTTGAAAATGAAATGACT
GTCTAAGAGATCTGGTCAAAGCAACTGGATACTAGATCTTACATCTGCAGCTCTTTCTTCTTTGAATTT
CCTATCTGTATGTCTGCCTAATTAAAAAAATATATATTGTATTATGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001639.4
Synonyms HEL-S-92n; PTX2; SAP
Summary The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
Locus ID 325
MW 7.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...