RPB2 (POLR2B) (NM_000938) Human 3' UTR Clone

CAT#: SC201911

3' UTR clone of polymerase (RNA) II (DNA directed) polypeptide B 140kDa (POLR2B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPB2 (POLR2B) (NM_000938) Human 3' UTR Clone
Vector pMirTarget
Synonyms hRPB140; POL2RB; RPB2
ACCN NM_000938
Insert Size 200 bp
Sequence Data
>SC201911 3’UTR clone of NM_000938
The sequence shown below is from the reference sequence of NM_000938. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTATTGCACCGCGAATGATGAGTGTTTAGCTATTTTACAGGAGTCAACAAGATAATTAAATATCTTGG
TGTCTTGTTTCTATTGTGTGGCTTTTTAAAAATGACAAATATGTACTGTGTTGTGATAAAAAGTATTTT
ATTTGTTTAATGATATGCATGCTTTTCTTCTGTAAATATATAATAAATTTTTGTAGATAGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000938.3
Synonyms hRPB140; POL2RB; RPB2
Summary This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Locus ID 5431
MW 7.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...