SDHB (NM_003000) Human 3' UTR Clone

CAT#: SC201673

3' UTR clone of succinate dehydrogenase complex subunit B iron sulfur (Ip) (SDHB) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SDHB (NM_003000) Human 3' UTR Clone
Vector pMirTarget
Synonyms CWS2; IP; MC2DN4; PGL4; SDH; SDH1; SDH2; SDHIP
ACCN NM_003000
Insert Size 189 bp
Sequence Data
>SC201673 3’UTR clone of NM_003000
The sequence shown below is from the reference sequence of NM_003000. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCTATAAGGAGAAGAAAGCTTCAGTTTAACTGTTTCCATGCTAAACATGATTTATAACCAGCTCAGAG
CTGAACATAATTTATATCTAATTTGAGTTCCTTTAAAGATCTTGGTTTTCCATGAATACAGCATGTATA
ATAAAAATTTTAAGAAATAAATGTTATTCTACTTTATTAACAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003000.3
Synonyms CWS2; IP; MC2DN4; PGL4; SDH; SDH1; SDH2; SDHIP
Summary Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]
Locus ID 6390
MW 7.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...