Neuromedin B (NMB) (NM_205858) Human 3' UTR Clone

CAT#: SC201515

3' UTR clone of neuromedin B (NMB) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Neuromedin B (NMB) (NM_205858) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_205858
Insert Size 168 bp
Sequence Data
>SC201515 3’UTR clone of NM_205858
The sequence shown below is from the reference sequence of NM_205858. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGATGGCCCCATCTGGATGTAAATCCTGAGCTCAAATCTCTGTTACTCCATTACTGTGATTTCTGGCT
GGGTCACCAGAAATATCGCTGATGCAGACACAGATTATGTTCCTGCTGTATTTCCTGCTTCCCTGTTGA
ATTGGTGAATAAAACCTTGCTCTTTACATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_205858.2
Summary This gene encodes a member of the bombesin-like family of neuropeptides, which negatively regulate eating behavior. The encoded protein may regulate colonic smooth muscle contraction through binding to its cognate receptor, the neuromedin B receptor (NMBR). Polymorphisms of this gene may be associated with hunger, weight gain and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Locus ID 4828
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...