Ubiquinol Cytochrome C Reductase Core Protein I (UQCRC1) (NM_003365) Human 3' UTR Clone

CAT#: SC201375

3' UTR clone of ubiquinol-cytochrome c reductase core protein I (UQCRC1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Ubiquinol Cytochrome C Reductase Core Protein I (UQCRC1) (NM_003365) Human 3' UTR Clone
Vector pMirTarget
Synonyms D3S3191; QCR1; UQCR1
ACCN NM_003365
Insert Size 156 bp
Sequence Data
>SC201375 3’UTR clone of NM_003365
The sequence shown below is from the reference sequence of NM_003365. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTAGCGGCATGTTCTGGCTGCGCTTCTAGGCGGGAAGCCTATGTAAGCAAGAGGGCAGGGCCGGGGTT
TGTGGTCCCCCCCCCACCACAAACACAGCACTTCGGCTCCTCTAACCTGTGCCACAGGTGACCACCAAT
AAAATCCTCTGCTGAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003365.3
Synonyms D3S3191; QCR1; UQCR1
Summary This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1.[UniProtKB/Swiss-Prot Function]
Locus ID 7384
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...