Alpha 1 Acid Glycoprotein (ORM1) (NM_000607) Human 3' UTR Clone

CAT#: SC201065

3' UTR clone of orosomucoid 1 (ORM1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Alpha 1 Acid Glycoprotein (ORM1) (NM_000607) Human 3' UTR Clone
Vector pMirTarget
Synonyms AGP-A; AGP1; HEL-S-153w; ORM
ACCN NM_000607
Insert Size 152 bp
Sequence Data
>SC201065 3’UTR clone of NM_000607
The sequence shown below is from the reference sequence of NM_000607. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAGGAAACAGGAGGAGGGGGAATCCTAGCAGGACACAGCCTTGGATCAGGACAGAGACTTGGGGGCC
ATCCTGCCCCTCCAACCCGACATGTGTACCTCAGCTTTTTCCCTCACTTGCATCAATAAAGCTTCTGTG
TTTGGAACAGCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000607.4
Synonyms AGP-A; AGP1; HEL-S-153w; ORM
Summary This gene encodes a key acute phase plasma protein. Because of its increase due to acute inflammation, this protein is classified as an acute-phase reactant. The specific function of this protein has not yet been determined; however, it may be involved in aspects of immunosuppression. [provided by RefSeq, Jul 2008]
Locus ID 5004
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...