COQ3 (NM_017421) Human 3' UTR Clone

CAT#: SC201034

3' UTR clone of coenzyme Q3 homolog methyltransferase (S. cerevisiae) (COQ3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COQ3 (NM_017421) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA9819.1; DHHBMT; DHHBMTASE; UG0215E05
ACCN NM_017421
Insert Size 229 bp
Sequence Data
>SC201034 3’UTR clone of NM_017421
The sequence shown below is from the reference sequence of NM_017421. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGCTGTGCATGAAAAGCTGAAGAAATGAATTGTTTCTGAGAACTATAGTAATATGGCTTGGATATCT
GATGTTTTCAAATACAAAAATGTACAATTTATCCTTTGAGAGAGAATCATGAAGAAAAGAAGGTCAATA
AAAAGGGCTAAAACCTTGGACAAAAGTTTTTGTTATTTCGTCTAATAGCTACTTTCAAGGGATTCTGTG
AATAAAAAGTTTTGTCAAGATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017421.4
Synonyms bA9819.1; DHHBMT; DHHBMTASE; UG0215E05
Summary Ubiquinone, also known as coenzyme Q, or Q, is a critical component of the electron transport pathways of both eukaryotes and prokaryotes (Jonassen and Clarke, 2000 [PubMed 10777520]). This lipid consists of a hydrophobic isoprenoid tail and a quinone head group. The tail varies in length depending on the organism, but its purpose is to anchor coenzyme Q to the membrane. The quinone head group is responsible for the activity of coenzyme Q in the respiratory chain. The S. cerevisiae COQ3 gene encodes an O-methyltransferase required for 2 steps in the biosynthetic pathway of coenzyme Q. This enzyme methylates an early coenzyme Q intermediate, 3,4-dihydroxy-5-polyprenylbenzoic acid, as well as the final intermediate in the pathway, converting demethyl-ubiquinone to coenzyme Q. The COQ3 gene product is also capable of methylating the distinct prokaryotic early intermediate 2-hydroxy-6-polyprenyl phenol.[supplied by OMIM, Mar 2008]
Locus ID 51805
MW 9.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...