RFC4 (NM_181573) Human 3' UTR Clone

CAT#: SC200796

3' UTR clone of replication factor C (activator 1) 4 37kDa (RFC4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RFC4 (NM_181573) Human 3' UTR Clone
Vector pMirTarget
Synonyms A1; RFC37
ACCN NM_181573
Insert Size 99 bp
Sequence Data
>SC200796 3’UTR clone of NM_181573
The sequence shown below is from the reference sequence of NM_181573. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGATGCAGCAGTTATCTCAGAATTGTTAACGTGAATATATCTGGATGGGGGGTTTTGTAAATAATGAA
GTTGTAATAAAAATAAAATGACCAAAAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181573.3
Synonyms A1; RFC37
Summary The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kD. This gene encodes the 37 kD subunit. This subunit forms a core complex with the 36 and 40 kDa subunits. The core complex possesses DNA-dependent ATPase activity, which was found to be stimulated by PCNA in an in vitro system. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Locus ID 5984
MW 3.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...