TMEM147 (NM_032635) Human 3' UTR Clone

CAT#: SC200563

3' UTR clone of transmembrane protein 147 (TMEM147) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TMEM147 (NM_032635) Human 3' UTR Clone
Vector pMirTarget
Synonyms NIFIE14
ACCN NM_032635
Insert Size 109 bp
Sequence Data
>SC200563 3’UTR clone of NM_032635
The sequence shown below is from the reference sequence of NM_032635. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGTCGCCGTTGTCAATGTGCACTCCTAGGCTTGGTGTCTCAGACATTGATGTACCTTTTCCCTGCCT
CACTCCAGGTTTTAGTGAAGTAAACAGTATTTGGAAAGTT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032635.4
Synonyms NIFIE14
Summary Acts as a negative regulator of CHRM3 function, most likely by interfering with its trafficking to the cell membrane (PubMed:21056967). Negatively regulates CHRM3-mediated calcium mobilization and activation of RPS6KA1/p90RSK activity (PubMed:21056967).[UniProtKB/Swiss-Prot Function]
Locus ID 10430
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...