ARG2 Human qPCR Primer Pair (NM_001172)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 5,488.00
CNY 1,999.00
CNY 2,700.00
CNY 2,710.00
Specifications
Product Data | |
Gene ID | 384 |
Forward Sequence | CTGGCTTGATGAAAAGGCTCTCC |
Reverse Sequence | TGAGCGTGGATTCACTATCAGGT |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Transcriptional and Metabolomic Analysis of L-Arginine/Nitric Oxide Pathway in Inflammatory Bowel Disease and Its Association with Local Inflammatory and Angiogenic Response: Preliminary Findings
,Krzystek-Korpacka, M;Fleszar, MG;Bednarz-Misa, I;Lewandowski, Ł;Szczuka, I;Kempiński, R;Neubauer, K;,
Int J Mol Sci
,PubMed ID 32121248
[ARG2]
|
Aggressive Behavior in Silent Subtype III Pituitary Adenomas May Depend on Suppression of Local Immune Response: A Whole Transcriptome Analysis
,Richardson, TE;Shen, Z;Kanchwala, M;Xing, C;Filatenkov, A;Shang, P;MS, ;Barnett, S;Abedin, Z;Malter, JS;Raisanen, JM;Burns, DK;White, CL;Hatanpaa, KJ;,
J Neuropathol Exp Neuro
,PubMed ID 28922848
[ARG2]
|
Microenvironments in Tuberculous Granulomas Are Delineated by Distinct Populations of Macrophage Subsets and Expression of Nitric Oxide Synthase and Arginase Isoforms
,Joshua T. Mattila, Olabisi O. Ojo, Diane Kepka-Lenhart, Simeone Marino, Jin Hee Kim, Seok Yong Eum, Laura E. Via, Clifton E. Barry, III, Edwin Klein, Denise E. Kirschner, Sidney M. Morris, Jr., Philana Ling Lin, and JoAnne L. Flynn,
J. Immunol., Jul 2013; 191: 773 - 784.
,PubMed ID 23749634
[ARG2]
|
Documents
FAQs |
Resources
基因表达相关资源 |