Mouse Gm10804 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Gm10804
Locus ID	100038525
Kit Components	GA218755G1, Gm10804 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGAGAACTACGTCCTGCCA GA218755G2, Gm10804 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGACTAGTTAATGATACCAC GA218755G3, Gm10804 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGAGAGAGCTTTACTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NR_040532, NR_040533

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.