Aminoadipate aminotransferase (AADAT) (NM_001286683) Human Untagged Clone

CAT#: SC336043

AADAT (untagged) - Human aminoadipate aminotransferase (AADAT), transcript variant 4



  "NM_001286683" in other vectors (2)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-AADAT Antibody
    • 100 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KAT2; KATII; KYAT2
Vector pCMV6-Entry
Sequence Data
>SC336043 representing NM_001286683.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATTACGCACGGTTCATCACGGCAGCGAGCGCAGCCAGAAACCCTTCTCCCATCCGGACCATGACT
GACATATTGAGCAGAGGACCAAAATCGATGATCTCCTTGGCTGGTGGCTTACCAAATCCAAACATGTTT
CCTTTTAAGACTGCCGTAATCACTGTAGAAAATGGAAAGACCATCCAATTTGGAGAAGAGATGATGAAG
AGAGCACTTCAGTATTCTCCGAGTGCTGGAATTCCAGAGCTTTTGTCCTGGCTAAAACAGTTACAAATA
AAATTGCATAATCCTCCTACCATCCATTACCCACCCAGTCAAGGACAAATGGATCTATGTGTCACATCT
GGCAGCCAACAAGGTCTTTGTAAGGTGTTTGAAATGATCATTAATCCTGGAGATAATGTCCTCCTAGAT
GAACCTGCTTATTCAGGAACTCTTCAAAGTCTGCACCCACTGGGCTGCAACATTATTAATGTTGCCAGT
GATGAAAGTGGGATTGTTCCAGATTCCCTAAGAGACATACTTTCCAGATGGAAACCAGAAGATGCAAAG
AATCCCCAGAAAAACACCCCCAAATTTCTTTATACTGTTCCAAATGGCAACAACCCTACTGGAAACTCA
TTAACCAGTGAACGCAAAAAGGAAATCTATGAGCTTGCAAGAAAATATGATTTCCTCATAATAGAAGAT
GATCCTTACTATTTTCTCCAGTTTAACAAGTTCAGGGTACCAACATTTCTTTCCATGGATGTTGATGGA
CGTGTCATCAGAGCTGACTCTTTTTCAAAAATCATTTCCTCTGGGTTGAGAATAGGATTTTTAACTGGT
CCAAAACCCTTAATAGAGAGAGTTATTTTACACATACAAGTTTCAACATTGCACCCCAGCACTTTTAAC
CAGCTCATGATATCACAGCTTCTACACGAATGGGGAGAAGAAGGTTTCATGGCTCATGTAGACAGGGTT
ATTGATTTCTATAGTAACCAGAAGGATGCAATACTGGCAGCTGCAGACAAGTGGTTAACTGGTTTGGCA
GAATGGCATGTTCCTGCTGCTGGAATGTTTTTATGGATTAAAGTTAAAGGCATTAATGATGTAAAAGAA
CTGATTGAAGAAAAGGCCGTTAAGATGGGGGTATTAATGCTCCCTGGAAATGCTTTCTACGTCGATAGC
TCAGCTCCTAGCCCTTACTTGAGAGCATCCTTCTCTTCAGCTTCTCCAGAACAGATGGATGTGGCCTTC
CAGGTATTAGCACAACTTATAAAAGAATCTTTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001286683
Insert Size 1278 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286683.1
RefSeq Size 2193 bp
RefSeq ORF 1278 bp
Locus ID 51166
UniProt ID Q8N5Z0
Protein Pathways Lysine biosynthesis, Lysine degradation, Metabolic pathways, Tryptophan metabolism
MW 47.4 kDa
Gene Summary This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate in-frame splice junction at the 3' end of the first coding exon compared to variant 3. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 1, 2, and 4 all encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Aminoadipate aminotransferase产品

Customer Reviews 
Loading...