Nck (NCK1) (NM_001291999) Human Untagged Clone

CAT#: SC335736

NCK1 (untagged) - Human NCK adaptor protein 1 (NCK1), transcript variant 3



  "NM_001291999" in other vectors (2)

CNY 3,610.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-NCK1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NCK; nck-1; NCKalpha
Vector pCMV6-Entry
Sequence Data
>SC335736 representing NM_001291999.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGAAGAAGTGGTGGTAGTAGCCAAATTTGATTATGTGGCCCAACAAGAACAAGAGTTGGACATC
AAGAAGAATGAGAGATTATGGCTTCTGGATGATTCTAAGTCCTGGTGGCGAGTTCGAAATTCCATGAAT
AAAACAGGTTTTGTGCCTTCTAACTATGTGGAAAGGAAAAACAGTGCTCGGAAAGCATCTATTGTGAAA
AACCTAAAGGATACCTTAGGCATTGGAAAAGTGAAAAGAAAACCTAGTGTGCCAGATTCTGCATCTCCT
GCTGATGATAGTTTTGTTGACCCAGGGGAACGTCTCTATGACCTCAACATGCCCGCTTATGTGAAATTT
AACTACATGGCTGAGAGAGAGGATGAATTATCATTGATAAAGGGGACAAAGGTGATCGTCATGGAGAAA
TGCAGTGATGGGTGGTGGCGTGGTAGCTACAATGGACAAGTTGGATGGTTCCCTTCAAACTATGTAACT
GAAGAAGGTGACAGTCCTTTGGGTGACCATGTGGGTTCTCTGTCAGAGAAATTAGCAGCAGTCGTCAAT
AACCTAAATACTGGGCAAGTGTTGCATGTGGTACAGGCTCTTTACCCATTCAGCTCATCTAATGATGAA
GAACTTAATTTCGAGAAAGGAGATGTAATGGATGTTATTGAAAAACCTGAAAATGACCCAGAGTGGTGG
AAATGCAGGAAGATCAATGGTATGGTTGGTCTAGTACCAAAAAACTATGTTACCGTTATGCAGAATAAT
CCATTAACTTCAGGTTTGGAACCATCACCTCCACAGTGTGATTACATTAGGCCTTCACTCACTGGAAAG
TTTGCTGGCAATCCTTGGTATTATGGCAAAGTCACCAGGCATCAAGCAGAAATGGCATTAAATGAAAGA
GGACATGAAGGGGATTTCCTCATTCGTGATAGTGAATCTTCGCCAAATGATTTCTCAGTATCACTAAAA
GCACAAGGGAAAAACAAGCATTTTAAAGTCCAACTAAAAGAGACTGTCTACTGCATTGGGCAGCGTAAA
TTCAGCACCATGGAAGAACTTGTAGAACATTACAAAAAGGCACCAATTTTTACAAGTGAACAAGGAGAA
AAATTATATCTTGTCAAGCATTTATCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001291999
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291999.1
RefSeq Size 4455 bp
RefSeq ORF 1134 bp
Locus ID 4690
UniProt ID P16333
Protein Families Druggable Genome
Protein Pathways Axon guidance, ErbB signaling pathway, Pathogenic Escherichia coli infection, T cell receptor signaling pathway
MW 42.9 kDa
Gene Summary The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...