CLN3 (NM_001286109) Human Untagged Clone

CAT#: SC335607

CLN3 (untagged) - Human ceroid-lipofuscinosis, neuronal 3 (CLN3), transcript variant 5



  "NM_001286109" in other vectors (2)

CNY 3,420.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
CLN3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BTN1; BTS; JNCL
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286109, the custom clone sequence may differ by one or more nucleotides


ATGCTGAGTGCCGCCCACGACATCCTTAGCCACAAGAGGACATCGGGAAACCAGAGCCATGCTGTGCTCC
TGGCGGACATCCTCCCCACACTCGTCATCAAATTGTTGGCTCCTCTTGGCCTTCACCTGCTGCCCTACAG
CCCCCGGGTTCTCGTCAGTGGGATTTGTGCTGCTGGAAGCTTCGTCCTGGTTGCCTTTTCTCATTCTGTG
GGGACCAGCCTGTGTGGTGTGGTCTTCGCTAGCATCTCATCAGGCCTTGGGGAGGTCACCTTCCTCTCCC
TCACTGCCTTCTACCCCAGGGCCGTGATCTCCTGGTGGTCCTCAGGGACTGGGGGAGCTGGGCTGCTGGG
GGCCCTGTCCTACCTGGGCCTCACCCAGGCCGGCCTCTCCCCTCAGCAGACCCTGCTGTCCATGCTGGGT
ATCCCTGCCCTGCTGCTGGCCAGCTATTTCTTGTTGCTCACATCTCCTGAGGCCCAGGACCCTGGAGGGG
AAGAAGAAGCAGAGAGCGCAGCCCGGCAGCCCCTCATAAGAACCGAGGCCCCGGAGTCGAAGCCAGGCTC
CAGCTCCAGCCTCTCCCTTCGGGAAAGGTGGACAGTGTTCAAGGGTCTGCTGTGGTACATTGTTCCCTTG
GTCGTAGTTTACTTTGCCGAGTATTTCATTAACCAGGGACTTTTTGAACTCCTCTTTTTCTGGAACACTT
CCCTGAGTCACGCTCAGCAATACCGCTGGTACCAGATGCTGTACCAGGCTGGCGTCTTTGCCTCCCGCTC
TTCTCTCCGCTGCTGTCGCATCCGTTTCACCTGGGCCCTGGCCCTGCTGCAGTGCCTCAACCTGGTGTTC
CTGCTGGCAGACGTGTGGTTCGGCTTTCTGCCAAGCATCTACCTCGTCTTCCTGATCATTCTGTATGAGG
GGCTCCTGGGAGGCGCAGCCTACGTGAACACCTTCCACAACATCGCCCTGGAGACCAGTGATGAGCACCG
GGAGTTTGCAATGGCGGCCACCTGCATCTCTGACACACTGGGGATCTCCCTGTCGGGGCTCCTGGCTTTG
CCTCTGCATGACTTCCTCTGCCAGCTCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001286109
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286109.1, NP_001273038.1
RefSeq Size 1791 bp
RefSeq ORF 1083 bp
Locus ID 1201
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome
Gene Summary This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence, the 3' UTR, and lacks an alternate in-frame exon compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (d) with a shorter N-terminus and missing an alternate internal segment compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...