LAIR1 (NM_001289026) Human Untagged Clone

CAT#: SC335035

LAIR1 (untagged) - Human leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), transcript variant f



  "NM_001289026" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-LAIR1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD305; LAIR-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289026, the custom clone sequence may differ by one or more nucleotides


ATGGAAAGAGAAATGGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGATCTGCCCAGACCCTCCA
TCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTTCGTGTGCCGGGGCCCGGTTGG
GGTTCAAACATTCCGCCTGGAGAGGGACAGTAGATCCACATACAATGATACTGAAGATGTGTCTCAAGCT
AGTCCATCTGAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGAGAAGGAAATGCCGGGCTTTATCGCT
GCATCTATTATAAGCCCCCTAAATGGTCTGAGCAGAGTGACTACCTGGAGCTGCTGGTGAAAGAAAGCTC
TGGAGGCCCGGACTCCCCGGACACAGAGCCCGGCTCCTCAGCTGGACCCACGCAGAGGCCGTCGGACAAC
AGTCACAATGAGCATGCACCTGCTTCCCAAGGCCTGAAAGCTGAGCATCTGTATATTCTCATCGGGGTCT
CAGTGGTCTTCCTCTTCTGTCTCCTCCTCCTGGTCCTCTTCTGCCTCCATCGCCAGAATCAGATAAAGCA
GGGGCCCCCCAGAAGCAAGGACGAGGAGCAGAAGCCACAGCAGAGGCCTGACCTGGCTGTTGATGTTCTA
GAGAGGACAGCAGACAAGGCCACAGTCAATGGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCCC
TGGCTGCAGGGAGTTCCCAGGAGGTGACGTATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGC
CCGGGCTGTGTCCCCACAGTCCACAAAGCCCATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACAC
TGA


Restriction Sites SgfI-MluI     
ACCN NM_001289026
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289026.2, NP_001275955.2
RefSeq Size 2766 bp
RefSeq ORF 843 bp
Locus ID 3903
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (f) differs in the 5' UTR, lacks part of the 5' coding region, and uses an alternate start codon, compared to variant a. The encoded isoform (f) has a shorter and distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...